EMAIL THIS PAGE TO A FRIEND

HSD3B7

hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7

80 Gene Product Result for
Synonyms: CBAS1 PFIC4 SDR11E3
UniProtKB ID: Q9H2F3, Q96M28, Q9BSN9
Gene ID:
Human(80270) Summary: This gene encodes an enzyme which is involved in the initial stages of the synthesis of bile acids from cholesterol and a member of the short-chain dehydrogenase/reductase superfamily. The encoded protein is a membrane-associated endoplasmic reticulum protein which is active against 7-alpha hydrosylated sterol substrates. Mutations in this gene are associated with a congenital bile acid synthesis defect which leads to neonatal cholestasis, a form of progressive liver disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(101502) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Rat(246211) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
sheep(101105716) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
domestic guinea pig(100716211) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
naked mole-rat(101708818) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Zebrafish(327462) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase
chicken(417505) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
cow(540229) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
domestic cat(101090824) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
dog(489917) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133943 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133943 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133943 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025193 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025193 Rosetta Predictions human pricing
NM_139329 Rosetta Predictions rat pricing
NM_001040684 Rosetta Predictions mouse pricing
NM_133943 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016385 predicted 774
2 SASI_Hs01_00016386 predicted 960
3 SASI_Hs01_00016387 predicted 842
4 SASI_Hs01_00016389 predicted 426
5 SASI_Hs01_00016390 predicted 866
6 SASI_Hs02_00357967 predicted 834
7 SASI_Hs01_00016391 predicted 449
8 SASI_Hs01_00016392 predicted 851
9 SASI_Hs01_00016393 predicted 1094
10 SASI_Hs02_00357968 predicted 428
11 SASI_Hs01_00016388 predicted 881
12 SASI_Hs01_00016394 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139329 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268580 predicted 335
2 SASI_Rn02_00268581 predicted 706
3 SASI_Rn02_00268582 predicted 1263
4 SASI_Rn02_00268583 predicted 489
5 SASI_Rn02_00268584 predicted 789
6 SASI_Rn02_00268585 predicted 847
7 SASI_Rn02_00268586 predicted 771
8 SASI_Rn02_00268587 predicted 425
9 SASI_Rn02_00268588 predicted 1214
10 SASI_Rn02_00268589 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058330 predicted 1352
2 SASI_Mm01_00058331 predicted 636
3 SASI_Mm01_00058332 predicted 383
4 SASI_Mm01_00058333 predicted 1427
5 SASI_Mm01_00058334 predicted 826
6 SASI_Mm01_00058335 predicted 628
7 SASI_Mm01_00058336 predicted 383
8 SASI_Mm01_00058337 predicted 739
9 SASI_Mm01_00058338 predicted 343
10 SASI_Mm01_00058339 predicted 827
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133943 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029920 predicted 1404
2 SASI_Mm01_00029921 predicted 687
3 SASI_Mm01_00029922 predicted 435
4 SASI_Mm01_00029923 predicted 1475
5 SASI_Mm01_00029924 predicted 883
6 SASI_Mm01_00029925 predicted 685
7 SASI_Mm01_00029926 predicted 433
8 SASI_Mm01_00029927 predicted 791
9 SASI_Mm01_00029928 predicted 395
10 SASI_Mm01_00029929 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133943
VALIDATED
HSD3B7 MISSION shRNA Bacterial Glycerol Stock
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-421s1c1
Sequence:CCGGCCTGGTCTACACGAGCAGCATCTCGAGATGCTGCTCGTGTAGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133943.1-371s1c1
Sequence:CCGGCAGGGCACACAGAATGTGATTCTCGAGAATCACATTCTGTGTGCCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-311s1c1
Sequence:CCGGGCTGGGTTGGTGGATGTGTTTCTCGAGAAACACATCCACCAACCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-283s1c1
Sequence:CCGGGTCTGGATCACATGTGGTCATCTCGAGATGACCACATGTGATCCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-340s1c1
Sequence:CCGGCAGTCCAAAGACCATCCACAACTCGAGTTGTGGATGGTCTTTGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133943
VALIDATED
HSD3B7 MISSION shRNA shRNA Plasmid DNA
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-421s1c1
Sequence:CCGGCCTGGTCTACACGAGCAGCATCTCGAGATGCTGCTCGTGTAGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133943.1-371s1c1
Sequence:CCGGCAGGGCACACAGAATGTGATTCTCGAGAATCACATTCTGTGTGCCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-311s1c1
Sequence:CCGGGCTGGGTTGGTGGATGTGTTTCTCGAGAAACACATCCACCAACCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-283s1c1
Sequence:CCGGGTCTGGATCACATGTGGTCATCTCGAGATGACCACATGTGATCCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-340s1c1
Sequence:CCGGCAGTCCAAAGACCATCCACAACTCGAGTTGTGGATGGTCTTTGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133943
VALIDATED
HSD3B7 MISSION shRNA Lentiviral Transduction Particles
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-421s1c1
Sequence:CCGGCCTGGTCTACACGAGCAGCATCTCGAGATGCTGCTCGTGTAGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133943.1-371s1c1
Sequence:CCGGCAGGGCACACAGAATGTGATTCTCGAGAATCACATTCTGTGTGCCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-311s1c1
Sequence:CCGGGCTGGGTTGGTGGATGTGTTTCTCGAGAAACACATCCACCAACCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-283s1c1
Sequence:CCGGGTCTGGATCACATGTGGTCATCTCGAGATGACCACATGTGATCCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133943.1-340s1c1
Sequence:CCGGCAGTCCAAAGACCATCCACAACTCGAGTTGTGGATGGTCTTTGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025193
VALIDATED
HSD3B7 MISSION shRNA Bacterial Glycerol Stock
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025193.2-888s1c1
Sequence:CCGGCAGGAGCTATGAGGATTTCAACTCGAGTTGAAATCCTCATAGCTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025193.2-856s1c1
Sequence:CCGGCAGGTATACTTCTGCTACGATCTCGAGATCGTAGCAGAAGTATACCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025193.2-687s1c1
Sequence:CCGGCCACCAGATCATGAGGGACTTCTCGAGAAGTCCCTCATGATCTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025193.2-379s1c1
Sequence:CCGGGCCAGTCCCAAGACCATCCATCTCGAGATGGATGGTCTTGGGACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-700s21c1
Sequence:CCGGCCACCAGATCATGAGGGACTTCTCGAGAAGTCCCTCATGATCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-789s21c1
Sequence:CCGGGGGTCTATGTGGGCAATGTTGCTCGAGCAACATTGCCCACATAGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-897s21c1
Sequence:CCGGCCTACAGGAGCTACGAGGATTCTCGAGAATCCTCGTAGCTCCTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025193.3-1120s21c1
Sequence:CCGGTCAGCGCCATTTCGGCTATGACTCGAGTCATAGCCGAAATGGCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-1349s21c1
Sequence:CCGGGTCGTAGAGCCCTCCACATTTCTCGAGAAATGTGGAGGGCTCTACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025193
VALIDATED
HSD3B7 MISSION shRNA shRNA Plasmid DNA
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025193.2-888s1c1
Sequence:CCGGCAGGAGCTATGAGGATTTCAACTCGAGTTGAAATCCTCATAGCTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025193.2-856s1c1
Sequence:CCGGCAGGTATACTTCTGCTACGATCTCGAGATCGTAGCAGAAGTATACCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025193.2-687s1c1
Sequence:CCGGCCACCAGATCATGAGGGACTTCTCGAGAAGTCCCTCATGATCTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025193.2-379s1c1
Sequence:CCGGGCCAGTCCCAAGACCATCCATCTCGAGATGGATGGTCTTGGGACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-700s21c1
Sequence:CCGGCCACCAGATCATGAGGGACTTCTCGAGAAGTCCCTCATGATCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-789s21c1
Sequence:CCGGGGGTCTATGTGGGCAATGTTGCTCGAGCAACATTGCCCACATAGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-897s21c1
Sequence:CCGGCCTACAGGAGCTACGAGGATTCTCGAGAATCCTCGTAGCTCCTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025193.3-1120s21c1
Sequence:CCGGTCAGCGCCATTTCGGCTATGACTCGAGTCATAGCCGAAATGGCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-1349s21c1
Sequence:CCGGGTCGTAGAGCCCTCCACATTTCTCGAGAAATGTGGAGGGCTCTACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025193
VALIDATED
HSD3B7 MISSION shRNA Lentiviral Transduction Particles
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025193.2-888s1c1
Sequence:CCGGCAGGAGCTATGAGGATTTCAACTCGAGTTGAAATCCTCATAGCTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025193.2-856s1c1
Sequence:CCGGCAGGTATACTTCTGCTACGATCTCGAGATCGTAGCAGAAGTATACCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025193.2-687s1c1
Sequence:CCGGCCACCAGATCATGAGGGACTTCTCGAGAAGTCCCTCATGATCTGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_025193.2-379s1c1
Sequence:CCGGGCCAGTCCCAAGACCATCCATCTCGAGATGGATGGTCTTGGGACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-700s21c1
Sequence:CCGGCCACCAGATCATGAGGGACTTCTCGAGAAGTCCCTCATGATCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-789s21c1
Sequence:CCGGGGGTCTATGTGGGCAATGTTGCTCGAGCAACATTGCCCACATAGACCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-897s21c1
Sequence:CCGGCCTACAGGAGCTACGAGGATTCTCGAGAATCCTCGTAGCTCCTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025193.3-1120s21c1
Sequence:CCGGTCAGCGCCATTTCGGCTATGACTCGAGTCATAGCCGAAATGGCGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_025193.3-1349s21c1
Sequence:CCGGGTCGTAGAGCCCTCCACATTTCTCGAGAAATGTGGAGGGCTCTACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)