EMAIL THIS PAGE TO A FRIEND

HSD3BP2

hydroxy-delta-5-steroid dehydrogenase, 3 beta, pseudogene 2

Gene Product Result for
Species: Human HSD3BP2(440606)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_496385
HSD3BP2 MISSION shRNA Bacterial Glycerol Stock
hydroxy-delta-5-steroid dehydrogenase, 3 beta, pseudogene 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-260s1c1
Sequence:CCGGCCTATGTAACATCACCTTTATCTCGAGATAAAGGTGATGTTACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-31s1c1
Sequence:CCGGCTTGTAGTTGAGCTAAATGAACTCGAGTTCATTTAGCTCAACTACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-293s1c1
Sequence:CCGGCAGCTAGATACAGAAATCATTCTCGAGAATGATTTCTGTATCTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-110s1c1
Sequence:CCGGAGACACCCAATACAGCCAAATCTCGAGATTTGGCTGTATTGGGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-493s1c1
Sequence:CCGGGTCAATGTGAAAGCTCCTGTTCTCGAGAACAGGAGCTTTCACATTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_496385
HSD3BP2 MISSION shRNA shRNA Plasmid DNA
hydroxy-delta-5-steroid dehydrogenase, 3 beta, pseudogene 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-260s1c1
Sequence:CCGGCCTATGTAACATCACCTTTATCTCGAGATAAAGGTGATGTTACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-31s1c1
Sequence:CCGGCTTGTAGTTGAGCTAAATGAACTCGAGTTCATTTAGCTCAACTACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-293s1c1
Sequence:CCGGCAGCTAGATACAGAAATCATTCTCGAGAATGATTTCTGTATCTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-110s1c1
Sequence:CCGGAGACACCCAATACAGCCAAATCTCGAGATTTGGCTGTATTGGGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-493s1c1
Sequence:CCGGGTCAATGTGAAAGCTCCTGTTCTCGAGAACAGGAGCTTTCACATTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_496385
HSD3BP2 MISSION shRNA Lentiviral Transduction Particles
hydroxy-delta-5-steroid dehydrogenase, 3 beta, pseudogene 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-260s1c1
Sequence:CCGGCCTATGTAACATCACCTTTATCTCGAGATAAAGGTGATGTTACATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-31s1c1
Sequence:CCGGCTTGTAGTTGAGCTAAATGAACTCGAGTTCATTTAGCTCAACTACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-293s1c1
Sequence:CCGGCAGCTAGATACAGAAATCATTCTCGAGAATGATTTCTGTATCTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-110s1c1
Sequence:CCGGAGACACCCAATACAGCCAAATCTCGAGATTTGGCTGTATTGGGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_496385.1-493s1c1
Sequence:CCGGGTCAATGTGAAAGCTCCTGTTCTCGAGAACAGGAGCTTTCACATTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)