EMAIL THIS PAGE TO A FRIEND

HSDL1

hydroxysteroid dehydrogenase like 1

79 Gene Product Result for
Synonyms: SDR12C3
UniProtKB ID: Q3SXM5, B4DSL2, D3DUL4, Q3SXM4, Q8NC98, Q9BY22
Gene ID:
Mouse(72552) hydroxysteroid dehydrogenase like 1
Rat(361418) hydroxysteroid dehydrogenase like 1
Zebrafish(494064) hydroxysteroid dehydrogenase like 1
cow(505213) hydroxysteroid dehydrogenase like 1
domestic cat(101087630) hydroxysteroid dehydrogenase like 1
dog(479629) hydroxysteroid dehydrogenase like 1
chicken(415703) hydroxysteroid dehydrogenase like 1
domestic guinea pig(100730405) hydroxysteroid dehydrogenase like 1
naked mole-rat(101713058) hydroxysteroid dehydrogenase like 1
sheep(101102168) hydroxysteroid dehydrogenase like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175185 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175185 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175185 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031463 Rosetta Predictions human pricing
NM_001024896 Rosetta Predictions rat pricing
NM_175185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232082 predicted 365
2 SASI_Hs01_00232083 predicted 1111
3 SASI_Hs01_00232084 predicted 837
4 SASI_Hs01_00232085 predicted 860
5 SASI_Hs01_00232086 predicted 802
6 SASI_Hs01_00232087 predicted 467
7 SASI_Hs01_00232088 predicted 447
8 SASI_Hs01_00232089 predicted 686
9 SASI_Hs01_00232090 predicted 1010
10 SASI_Hs01_00232091 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024896 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034871 predicted 507
2 SASI_Rn01_00034872 predicted 1155
3 SASI_Rn02_00202794 predicted 672
4 SASI_Rn01_00034873 predicted 1393
5 SASI_Rn01_00034874 predicted 1020
6 SASI_Rn01_00034876 predicted 644
7 SASI_Rn01_00034877 predicted 1041
8 SASI_Rn01_00034878 predicted 1369
9 SASI_Rn01_00034879 predicted 447
10 SASI_Rn01_00034880 predicted 374
11 SASI_Rn01_00034875 predicted 1357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119367 predicted 932
2 SASI_Mm01_00119368 predicted 962
3 SASI_Mm01_00119369 predicted 519
4 SASI_Mm01_00119370 predicted 1045
5 SASI_Mm01_00119371 predicted 1070
6 SASI_Mm01_00119372 predicted 1132
7 SASI_Mm01_00119373 predicted 1066
8 SASI_Mm01_00119374 predicted 908
9 SASI_Mm01_00119375 predicted 589
10 SASI_Mm01_00119376 predicted 976
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031463
VALIDATED
HSDL1 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid dehydrogenase like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_031463.3-983s1c1
Sequence:CCGGGCTGTTTCTACTCTTGGGATTCTCGAGAATCCCAAGAGTAGAAACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_031463.3-580s1c1
Sequence:CCGGCGTTGGCATCTTGGTAAATAACTCGAGTTATTTACCAAGATGCCAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031463.3-844s1c1
Sequence:CCGGGCAATATGAATATGCCTCTAACTCGAGTTAGAGGCATATTCATATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_031463.3-393s1c1
Sequence:CCGGCCTACGCTGAAGAGTTAGCAACTCGAGTTGCTAACTCTTCAGCGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_031463.3-689s1c1
Sequence:CCGGGCTAGTTTGATGGTCCATGTTCTCGAGAACATGGACCATCAAACTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031463.4-1359s21c1
Sequence:CCGGTGGATGGCACAGGATCAATAACTCGAGTTATTGATCCTGTGCCATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031463.4-1492s21c1
Sequence:CCGGATGATTTGTCAGGTCTTATAACTCGAGTTATAAGACCTGACAAATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031463.4-1616s21c1
Sequence:CCGGACTAAGATTGCTGGTACTATTCTCGAGAATAGTACCAGCAATCTTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031463
VALIDATED
HSDL1 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid dehydrogenase like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_031463.3-983s1c1
Sequence:CCGGGCTGTTTCTACTCTTGGGATTCTCGAGAATCCCAAGAGTAGAAACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_031463.3-580s1c1
Sequence:CCGGCGTTGGCATCTTGGTAAATAACTCGAGTTATTTACCAAGATGCCAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031463.3-844s1c1
Sequence:CCGGGCAATATGAATATGCCTCTAACTCGAGTTAGAGGCATATTCATATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_031463.3-393s1c1
Sequence:CCGGCCTACGCTGAAGAGTTAGCAACTCGAGTTGCTAACTCTTCAGCGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_031463.3-689s1c1
Sequence:CCGGGCTAGTTTGATGGTCCATGTTCTCGAGAACATGGACCATCAAACTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031463.4-1359s21c1
Sequence:CCGGTGGATGGCACAGGATCAATAACTCGAGTTATTGATCCTGTGCCATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031463.4-1492s21c1
Sequence:CCGGATGATTTGTCAGGTCTTATAACTCGAGTTATAAGACCTGACAAATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031463.4-1616s21c1
Sequence:CCGGACTAAGATTGCTGGTACTATTCTCGAGAATAGTACCAGCAATCTTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031463
VALIDATED
HSDL1 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid dehydrogenase like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_031463.3-983s1c1
Sequence:CCGGGCTGTTTCTACTCTTGGGATTCTCGAGAATCCCAAGAGTAGAAACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_031463.3-580s1c1
Sequence:CCGGCGTTGGCATCTTGGTAAATAACTCGAGTTATTTACCAAGATGCCAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031463.3-844s1c1
Sequence:CCGGGCAATATGAATATGCCTCTAACTCGAGTTAGAGGCATATTCATATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_031463.3-393s1c1
Sequence:CCGGCCTACGCTGAAGAGTTAGCAACTCGAGTTGCTAACTCTTCAGCGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_031463.3-689s1c1
Sequence:CCGGGCTAGTTTGATGGTCCATGTTCTCGAGAACATGGACCATCAAACTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031463.4-1359s21c1
Sequence:CCGGTGGATGGCACAGGATCAATAACTCGAGTTATTGATCCTGTGCCATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031463.4-1492s21c1
Sequence:CCGGATGATTTGTCAGGTCTTATAACTCGAGTTATAAGACCTGACAAATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031463.4-1616s21c1
Sequence:CCGGACTAAGATTGCTGGTACTATTCTCGAGAATAGTACCAGCAATCTTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175185
VALIDATED
HSDL1 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid dehydrogenase like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-992s1c1
Sequence:CCGGAGTTCCTCTTCGCACAGTATACTCGAGTATACTGTGCGAAGAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175185.2-369s1c1
Sequence:CCGGCGGACTCAATGTCATCCTGATCTCGAGATCAGGATGACATTGAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-1058s1c1
Sequence:CCGGCCTTACGGAAAGAGGCCTTATCTCGAGATAAGGCCTCTTTCCGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-795s1c1
Sequence:CCGGGCAGTACGAGTATGCCTCTAACTCGAGTTAGAGGCATACTCGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-2169s1c1
Sequence:CCGGGCGTGGTATAAGGTAGTTATTCTCGAGAATAACTACCTTATACCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175185
VALIDATED
HSDL1 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid dehydrogenase like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-992s1c1
Sequence:CCGGAGTTCCTCTTCGCACAGTATACTCGAGTATACTGTGCGAAGAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175185.2-369s1c1
Sequence:CCGGCGGACTCAATGTCATCCTGATCTCGAGATCAGGATGACATTGAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-1058s1c1
Sequence:CCGGCCTTACGGAAAGAGGCCTTATCTCGAGATAAGGCCTCTTTCCGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-795s1c1
Sequence:CCGGGCAGTACGAGTATGCCTCTAACTCGAGTTAGAGGCATACTCGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-2169s1c1
Sequence:CCGGGCGTGGTATAAGGTAGTTATTCTCGAGAATAACTACCTTATACCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175185
VALIDATED
HSDL1 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid dehydrogenase like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-992s1c1
Sequence:CCGGAGTTCCTCTTCGCACAGTATACTCGAGTATACTGTGCGAAGAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175185.2-369s1c1
Sequence:CCGGCGGACTCAATGTCATCCTGATCTCGAGATCAGGATGACATTGAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-1058s1c1
Sequence:CCGGCCTTACGGAAAGAGGCCTTATCTCGAGATAAGGCCTCTTTCCGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-795s1c1
Sequence:CCGGGCAGTACGAGTATGCCTCTAACTCGAGTTAGAGGCATACTCGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175185.2-2169s1c1
Sequence:CCGGGCGTGGTATAAGGTAGTTATTCTCGAGAATAACTACCTTATACCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)