EMAIL THIS PAGE TO A FRIEND

HSDL2

hydroxysteroid dehydrogenase like 2

65 Gene Product Result for
Synonyms: C9orf99 SDR13C1
UniProtKB ID: Q6YN16, A8K1L4, A8K8X1, A8MSV3, Q658M8, Q9BT58
Gene ID:
Mouse(72479) hydroxysteroid dehydrogenase like 2
Rat(313200) hydroxysteroid dehydrogenase like 2
sheep(101110995) hydroxysteroid dehydrogenase like 2
domestic guinea pig(100717243) hydroxysteroid dehydrogenase like 2
naked mole-rat(101713586) hydroxysteroid dehydrogenase like 2
Zebrafish(322347) hydroxysteroid dehydrogenase like 2
chicken(100858057) hydroxysteroid dehydrogenase like 2
Horse(100057249) hydroxysteroid dehydrogenase like 2
cow(404131) hydroxysteroid dehydrogenase like 2
domestic cat(101094216) hydroxysteroid dehydrogenase like 2
dog(474804) hydroxysteroid dehydrogenase like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032303 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032303 Rosetta Predictions human pricing
NM_001025697 Rosetta Predictions rat pricing
NM_024255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015129 predicted 248
2 SASI_Hs01_00015130 predicted 602
3 SASI_Hs01_00015132 predicted 238
4 SASI_Hs01_00015133 predicted 567
5 SASI_Hs02_00359649 predicted 1055
6 SASI_Hs01_00015134 predicted 584
7 SASI_Hs01_00015135 predicted 488
8 SASI_Hs01_00015136 predicted 440
9 SASI_Hs01_00015137 predicted 361
10 SASI_Hs01_00015138 predicted 361
11 SASI_Hs01_00015131 predicted 815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025697 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121785 predicted 509
2 SASI_Rn01_00121786 predicted 624
3 SASI_Rn01_00121787 predicted 1665
4 SASI_Rn01_00121789 predicted 1619
5 SASI_Rn01_00121790 predicted 655
6 SASI_Rn01_00121792 predicted 1772
7 SASI_Rn02_00203316 predicted 381
8 SASI_Rn01_00121793 predicted 1707
9 SASI_Rn01_00121794 predicted 697
10 SASI_Rn02_00203317 predicted 749
11 SASI_Rn01_00121788 predicted 389
12 SASI_Rn01_00121791 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024442 predicted 513
2 SASI_Mm02_00327643 predicted 476
3 SASI_Mm01_00024443 predicted 385
4 SASI_Mm01_00024444 predicted 1571
5 SASI_Mm02_00327644 predicted 455
6 SASI_Mm01_00024445 predicted 675
7 SASI_Mm01_00024447 predicted 665
8 SASI_Mm01_00024448 predicted 711
9 SASI_Mm01_00024449 predicted 1710
10 SASI_Mm01_00024451 predicted 1610
11 SASI_Mm01_00024446 predicted 575
12 SASI_Mm01_00024450 predicted 1644
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024255
VALIDATED
HSDL2 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid dehydrogenase like 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-836s21c1
Sequence:CCGGTCATTGCGGACGCTGCATATTCTCGAGAATATGCAGCGTCCGCAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-1370s21c1
Sequence:CCGGCACAAGCTGTCTATCAGTTTGCTCGAGCAAACTGATAGACAGCTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-1491s21c1
Sequence:CCGGGAGTATGGCCACTGATGATTTCTCGAGAAATCATCAGTGGCCATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-464s21c1
Sequence:CCGGTGAACAATGCCAGTGCTATTACTCGAGTAATAGCACTGGCATTGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-963s21c1
Sequence:CCGGTCATCCCTTGTTACCGGATTTCTCGAGAAATCCGGTAACAAGGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024255.2-1413s21c1
Sequence:CCGGTACGTGGTTTCTTGATCTAAACTCGAGTTTAGATCAAGAAACCACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024255.1-1631s1c1
Sequence:CCGGCCCACTGTCATGTAAGGACATCTCGAGATGTCCTTACATGACAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024255.1-1513s1c1
Sequence:CCGGGCAATCAAATTGGAGAAGCTACTCGAGTAGCTTCTCCAATTTGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024255.1-455s1c1
Sequence:CCGGCCTACCTTACATCCAAAGCATCTCGAGATGCTTTGGATGTAAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024255.1-617s1c1
Sequence:CCGGCTGAAGAATTTAGAGGTGAAACTCGAGTTTCACCTCTAAATTCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024255.1-616s1c1
Sequence:CCGGGCTGAAGAATTTAGAGGTGAACTCGAGTTCACCTCTAAATTCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024255
VALIDATED
HSDL2 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid dehydrogenase like 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-836s21c1
Sequence:CCGGTCATTGCGGACGCTGCATATTCTCGAGAATATGCAGCGTCCGCAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-1370s21c1
Sequence:CCGGCACAAGCTGTCTATCAGTTTGCTCGAGCAAACTGATAGACAGCTTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-1491s21c1
Sequence:CCGGGAGTATGGCCACTGATGATTTCTCGAGAAATCATCAGTGGCCATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-464s21c1
Sequence:CCGGTGAACAATGCCAGTGCTATTACTCGAGTAATAGCACTGGCATTGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-963s21c1
Sequence:CCGGTCATCCCTTGTTACCGGATTTCTCGAGAAATCCGGTAACAAGGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024255.2-1413s21c1
Sequence:CCGGTACGTGGTTTCTTGATCTAAACTCGAGTTTAGATCAAGAAACCACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024255.1-1631s1c1
Sequence:CCGGCCCACTGTCATGTAAGGACATCTCGAGATGTCCTTACATGACAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024255.1-1513s1c1
Sequence:CCGGGCAATCAAATTGGAGAAGCTACTCGAGTAGCTTCTCCAATTTGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024255.1-455s1c1
Sequence:CCGGCCTACCTTACATCCAAAGCATCTCGAGATGCTTTGGATGTAAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024255.1-617s1c1
Sequence:CCGGCTGAAGAATTTAGAGGTGAAACTCGAGTTTCACCTCTAAATTCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024255.1-616s1c1
Sequence:CCGGGCTGAAGAATTTAGAGGTGAACTCGAGTTCACCTCTAAATTCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024255
VALIDATED
HSDL2 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid dehydrogenase like 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-836s21c1
Sequence:CCGGTCATTGCGGACGCTGCATATTCTCGAGAATATGCAGCGTCCGCAATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-1370s21c1
Sequence:CCGGCACAAGCTGTCTATCAGTTTGCTCGAGCAAACTGATAGACAGCTTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-1491s21c1
Sequence:CCGGGAGTATGGCCACTGATGATTTCTCGAGAAATCATCAGTGGCCATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-464s21c1
Sequence:CCGGTGAACAATGCCAGTGCTATTACTCGAGTAATAGCACTGGCATTGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_024255.2-963s21c1
Sequence:CCGGTCATCCCTTGTTACCGGATTTCTCGAGAAATCCGGTAACAAGGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_024255.2-1413s21c1
Sequence:CCGGTACGTGGTTTCTTGATCTAAACTCGAGTTTAGATCAAGAAACCACGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024255.1-1631s1c1
Sequence:CCGGCCCACTGTCATGTAAGGACATCTCGAGATGTCCTTACATGACAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024255.1-1513s1c1
Sequence:CCGGGCAATCAAATTGGAGAAGCTACTCGAGTAGCTTCTCCAATTTGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024255.1-455s1c1
Sequence:CCGGCCTACCTTACATCCAAAGCATCTCGAGATGCTTTGGATGTAAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024255.1-617s1c1
Sequence:CCGGCTGAAGAATTTAGAGGTGAAACTCGAGTTTCACCTCTAAATTCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024255.1-616s1c1
Sequence:CCGGGCTGAAGAATTTAGAGGTGAACTCGAGTTCACCTCTAAATTCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032303
VALIDATED
HSDL2 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid dehydrogenase like 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-401s21c1
Sequence:CCGGGTGCCATTAGTTTGACCAATACTCGAGTATTGGTCAAACTAATGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-592s21c1
Sequence:CCGGGCTTATACCATTGCTAAGTATCTCGAGATACTTAGCAATGGTATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-925s21c1
Sequence:CCGGCCAGAAGCAGTTAGCAAGAAACTCGAGTTTCTTGCTAACTGCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-151s21c1
Sequence:CCGGCGTGGCATTGGCAAAGCTATTCTCGAGAATAGCTTTGCCAATGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-1300s1c1
Sequence:CCGGCCTAGCAATCAAATTGGAGAACTCGAGTTCTCCAATTTGATTGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-926s1c1
Sequence:CCGGCCAGAAGCAGTTAGCAAGAAACTCGAGTTTCTTGCTAACTGCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-402s1c1
Sequence:CCGGGTGCCATTAGTTTGACCAATACTCGAGTATTGGTCAAACTAATGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-152s1c1
Sequence:CCGGCGTGGCATTGGCAAAGCTATTCTCGAGAATAGCTTTGCCAATGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-593s1c1
Sequence:CCGGGCTTATACCATTGCTAAGTATCTCGAGATACTTAGCAATGGTATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032303
VALIDATED
HSDL2 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid dehydrogenase like 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-401s21c1
Sequence:CCGGGTGCCATTAGTTTGACCAATACTCGAGTATTGGTCAAACTAATGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-592s21c1
Sequence:CCGGGCTTATACCATTGCTAAGTATCTCGAGATACTTAGCAATGGTATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-925s21c1
Sequence:CCGGCCAGAAGCAGTTAGCAAGAAACTCGAGTTTCTTGCTAACTGCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-151s21c1
Sequence:CCGGCGTGGCATTGGCAAAGCTATTCTCGAGAATAGCTTTGCCAATGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-1300s1c1
Sequence:CCGGCCTAGCAATCAAATTGGAGAACTCGAGTTCTCCAATTTGATTGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-926s1c1
Sequence:CCGGCCAGAAGCAGTTAGCAAGAAACTCGAGTTTCTTGCTAACTGCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-402s1c1
Sequence:CCGGGTGCCATTAGTTTGACCAATACTCGAGTATTGGTCAAACTAATGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-152s1c1
Sequence:CCGGCGTGGCATTGGCAAAGCTATTCTCGAGAATAGCTTTGCCAATGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-593s1c1
Sequence:CCGGGCTTATACCATTGCTAAGTATCTCGAGATACTTAGCAATGGTATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032303
VALIDATED
HSDL2 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid dehydrogenase like 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-401s21c1
Sequence:CCGGGTGCCATTAGTTTGACCAATACTCGAGTATTGGTCAAACTAATGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-592s21c1
Sequence:CCGGGCTTATACCATTGCTAAGTATCTCGAGATACTTAGCAATGGTATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-925s21c1
Sequence:CCGGCCAGAAGCAGTTAGCAAGAAACTCGAGTTTCTTGCTAACTGCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032303.3-151s21c1
Sequence:CCGGCGTGGCATTGGCAAAGCTATTCTCGAGAATAGCTTTGCCAATGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-1300s1c1
Sequence:CCGGCCTAGCAATCAAATTGGAGAACTCGAGTTCTCCAATTTGATTGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-926s1c1
Sequence:CCGGCCAGAAGCAGTTAGCAAGAAACTCGAGTTTCTTGCTAACTGCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-402s1c1
Sequence:CCGGGTGCCATTAGTTTGACCAATACTCGAGTATTGGTCAAACTAATGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-152s1c1
Sequence:CCGGCGTGGCATTGGCAAAGCTATTCTCGAGAATAGCTTTGCCAATGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032303.2-593s1c1
Sequence:CCGGGCTTATACCATTGCTAAGTATCTCGAGATACTTAGCAATGGTATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)