EMAIL THIS PAGE TO A FRIEND

HSF2

heat shock transcription factor 2

110 Gene Product Result for
Synonyms: HSF 2 HSTF 2
UniProtKB ID: Q03933, B4DGJ4, Q0VAH9, Q2M1K4, Q9H445
Gene ID:
Human(3298) Summary: The protein encoded by this gene belongs to the HSF family of transcription factors that bind specifically to the heat-shock promoter element and activate transcription. Heat shock transcription factors activate heat-shock response genes under conditions of heat or other stresses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(15500) heat shock factor 2
Rat(64441) heat shock transcription factor 2
domestic guinea pig(100720931) heat shock transcription factor 2
naked mole-rat(101724500) heat shock transcription factor 2
sheep(101121861) heat shock transcription factor 2
Domestic Rabbit(100356373) heat shock transcription factor 2
Zebrafish(140427) heat shock factor 2
chicken(421724) heat shock transcription factor 2
domestic cat(101082407) heat shock transcription factor 2
Horse(100034128) heat shock transcription factor 2
cow(510557) heat shock transcription factor 2
dog(476276) heat shock transcription factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004506 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004506 Rosetta Predictions human pricing
NM_031694 Rosetta Predictions rat pricing
NM_008297 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004506 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096644 predicted 613
2 SASI_Hs01_00096645 predicted 1010
3 SASI_Hs02_00337774 predicted 1348
4 SASI_Hs01_00096647 predicted 1054
5 SASI_Hs01_00096649 predicted 1290
6 SASI_Hs01_00096650 predicted 326
7 SASI_Hs01_00096651 predicted 878
8 SASI_Hs01_00096652 predicted 1481
9 SASI_Hs01_00096653 predicted 1166
10 SASI_Hs02_00337775 predicted 738
11 SASI_Hs01_00096646 predicted 759
12 SASI_Hs01_00096648 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091230 predicted 891
2 SASI_Rn01_00091231 predicted 1355
3 SASI_Rn01_00091232 predicted 700
4 SASI_Rn01_00091233 predicted 1516
5 SASI_Rn01_00091234 predicted 1642
6 SASI_Rn02_00265048 predicted 405
7 SASI_Rn01_00091235 predicted 1204
8 SASI_Rn01_00091236 predicted 260
9 SASI_Rn01_00091237 predicted 1249
10 SASI_Rn01_00091238 predicted 1743
11 SASI_Rn01_00091239 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172645 predicted 543
2 SASI_Mm01_00172647 predicted 269
3 SASI_Mm01_00172648 predicted 1351
4 SASI_Mm01_00172649 predicted 981
5 SASI_Mm01_00172650 predicted 201
6 SASI_Mm01_00172652 predicted 252
7 SASI_Mm02_00313576 predicted 1106
8 SASI_Mm02_00313577 predicted 1124
9 SASI_Mm01_00172654 predicted 1476
10 SASI_Mm02_00313578 predicted 1278
11 SASI_Mm01_00172646 predicted 743
12 SASI_Mm01_00172651 predicted 1147
13 SASI_Mm01_00172653 predicted 1113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004506
VALIDATED
HSF2 MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-1157s21c1
Sequence:CCGGTCTAGTGCTGTCCAGCTAAATCTCGAGATTTAGCTGGACAGCACTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-1065s21c1
Sequence:CCGGATGAGTATGCACCTGTCATTCCTCGAGGAATGACAGGTGCATACTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-491s21c1
Sequence:CCGGGACTTGTTGGAGAACATTAAACTCGAGTTTAATGTTCTCCAACAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-1268s21c1
Sequence:CCGGTTGGATTATCTTGACAGTATTCTCGAGAATACTGTCAAGATAATCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-412s21c1
Sequence:CCGGTATCGACTCTGGAATTGTAAACTCGAGTTTACAATTCCAGAGTCGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-751s21c1
Sequence:CCGGTAACCAACTTGTGAGTTTAAACTCGAGTTTAAACTCACAAGTTGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-933s21c1
Sequence:CCGGATGATGTTACTGATGATAATGCTCGAGCATTATCATCAGTAACATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-614s1c1
Sequence:CCGGCGAAAGATTGTCCAGTTTATTCTCGAGAATAAACTGGACAATCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-822s21c1
Sequence:CCGGTGTTTCAGCACATAGTCAAAGCTCGAGCTTTGACTATGTGCTGAAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-1292s1c1
Sequence:CCGGCCCACAGATTACATCAATAATCTCGAGATTATTGATGTAATCTGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-236s1c1
Sequence:CCGGCCCAAATATTTCAAGCACAATCTCGAGATTGTGCTTGAAATATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-1395s1c1
Sequence:CCGGCCAAACCAGATAAGCAGCTTACTCGAGTAAGCTGCTTATCTGGTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_004506.2-1896s1c1
Sequence:CCGGCGCAGATGTAATGCACATTATCTCGAGATAATGTGCATTACATCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004506
VALIDATED
HSF2 MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-1157s21c1
Sequence:CCGGTCTAGTGCTGTCCAGCTAAATCTCGAGATTTAGCTGGACAGCACTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-1065s21c1
Sequence:CCGGATGAGTATGCACCTGTCATTCCTCGAGGAATGACAGGTGCATACTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-491s21c1
Sequence:CCGGGACTTGTTGGAGAACATTAAACTCGAGTTTAATGTTCTCCAACAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-1268s21c1
Sequence:CCGGTTGGATTATCTTGACAGTATTCTCGAGAATACTGTCAAGATAATCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-412s21c1
Sequence:CCGGTATCGACTCTGGAATTGTAAACTCGAGTTTACAATTCCAGAGTCGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-751s21c1
Sequence:CCGGTAACCAACTTGTGAGTTTAAACTCGAGTTTAAACTCACAAGTTGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-933s21c1
Sequence:CCGGATGATGTTACTGATGATAATGCTCGAGCATTATCATCAGTAACATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-614s1c1
Sequence:CCGGCGAAAGATTGTCCAGTTTATTCTCGAGAATAAACTGGACAATCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-822s21c1
Sequence:CCGGTGTTTCAGCACATAGTCAAAGCTCGAGCTTTGACTATGTGCTGAAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-1292s1c1
Sequence:CCGGCCCACAGATTACATCAATAATCTCGAGATTATTGATGTAATCTGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-236s1c1
Sequence:CCGGCCCAAATATTTCAAGCACAATCTCGAGATTGTGCTTGAAATATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-1395s1c1
Sequence:CCGGCCAAACCAGATAAGCAGCTTACTCGAGTAAGCTGCTTATCTGGTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_004506.2-1896s1c1
Sequence:CCGGCGCAGATGTAATGCACATTATCTCGAGATAATGTGCATTACATCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004506
VALIDATED
HSF2 MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-1157s21c1
Sequence:CCGGTCTAGTGCTGTCCAGCTAAATCTCGAGATTTAGCTGGACAGCACTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-1065s21c1
Sequence:CCGGATGAGTATGCACCTGTCATTCCTCGAGGAATGACAGGTGCATACTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-491s21c1
Sequence:CCGGGACTTGTTGGAGAACATTAAACTCGAGTTTAATGTTCTCCAACAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-1268s21c1
Sequence:CCGGTTGGATTATCTTGACAGTATTCTCGAGAATACTGTCAAGATAATCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-412s21c1
Sequence:CCGGTATCGACTCTGGAATTGTAAACTCGAGTTTACAATTCCAGAGTCGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-751s21c1
Sequence:CCGGTAACCAACTTGTGAGTTTAAACTCGAGTTTAAACTCACAAGTTGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-933s21c1
Sequence:CCGGATGATGTTACTGATGATAATGCTCGAGCATTATCATCAGTAACATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-614s1c1
Sequence:CCGGCGAAAGATTGTCCAGTTTATTCTCGAGAATAAACTGGACAATCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004506.3-822s21c1
Sequence:CCGGTGTTTCAGCACATAGTCAAAGCTCGAGCTTTGACTATGTGCTGAAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-1292s1c1
Sequence:CCGGCCCACAGATTACATCAATAATCTCGAGATTATTGATGTAATCTGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-236s1c1
Sequence:CCGGCCCAAATATTTCAAGCACAATCTCGAGATTGTGCTTGAAATATTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004506.2-1395s1c1
Sequence:CCGGCCAAACCAGATAAGCAGCTTACTCGAGTAAGCTGCTTATCTGGTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_004506.2-1896s1c1
Sequence:CCGGCGCAGATGTAATGCACATTATCTCGAGATAATGTGCATTACATCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008297
HSF2 MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008297.3-1846s21c1
Sequence:CCGGTACTCGACTGCCTAGGCATATCTCGAGATATGCCTAGGCAGTCGAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008297.2-1884s1c1
Sequence:CCGGCCCAGCTAAACTTGTTTATTTCTCGAGAAATAAACAAGTTTAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-617s1c1
Sequence:CCGGGCCTCTACTTCTAAACACAAACTCGAGTTTGTGTTTAGAAGTAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-1057s1c1
Sequence:CCGGCCATTCTGAATGACAACATTACTCGAGTAATGTTGTCATTCAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-198s1c1
Sequence:CCGGGCGAGCTTTGTGAGACAACTACTCGAGTAGTTGTCTCACAAAGCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008297.3-785s21c1
Sequence:CCGGACTGATAATCACCATCATAAACTCGAGTTTATGATGGTGATTATCAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008297.3-844s21c1
Sequence:CCGGACGGATTTCAGATGACATAATCTCGAGATTATGTCATCTGAAATCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-1389s1c1
Sequence:CCGGCCTTCTGTAGATAAACCCATACTCGAGTATGGGTTTATCTACAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008297
HSF2 MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008297.3-1846s21c1
Sequence:CCGGTACTCGACTGCCTAGGCATATCTCGAGATATGCCTAGGCAGTCGAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008297.2-1884s1c1
Sequence:CCGGCCCAGCTAAACTTGTTTATTTCTCGAGAAATAAACAAGTTTAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-617s1c1
Sequence:CCGGGCCTCTACTTCTAAACACAAACTCGAGTTTGTGTTTAGAAGTAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-1057s1c1
Sequence:CCGGCCATTCTGAATGACAACATTACTCGAGTAATGTTGTCATTCAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-198s1c1
Sequence:CCGGGCGAGCTTTGTGAGACAACTACTCGAGTAGTTGTCTCACAAAGCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008297.3-785s21c1
Sequence:CCGGACTGATAATCACCATCATAAACTCGAGTTTATGATGGTGATTATCAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008297.3-844s21c1
Sequence:CCGGACGGATTTCAGATGACATAATCTCGAGATTATGTCATCTGAAATCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-1389s1c1
Sequence:CCGGCCTTCTGTAGATAAACCCATACTCGAGTATGGGTTTATCTACAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008297
HSF2 MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008297.3-1846s21c1
Sequence:CCGGTACTCGACTGCCTAGGCATATCTCGAGATATGCCTAGGCAGTCGAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008297.2-1884s1c1
Sequence:CCGGCCCAGCTAAACTTGTTTATTTCTCGAGAAATAAACAAGTTTAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-617s1c1
Sequence:CCGGGCCTCTACTTCTAAACACAAACTCGAGTTTGTGTTTAGAAGTAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-1057s1c1
Sequence:CCGGCCATTCTGAATGACAACATTACTCGAGTAATGTTGTCATTCAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-198s1c1
Sequence:CCGGGCGAGCTTTGTGAGACAACTACTCGAGTAGTTGTCTCACAAAGCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008297.3-785s21c1
Sequence:CCGGACTGATAATCACCATCATAAACTCGAGTTTATGATGGTGATTATCAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008297.3-844s21c1
Sequence:CCGGACGGATTTCAGATGACATAATCTCGAGATTATGTCATCTGAAATCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008297.2-1389s1c1
Sequence:CCGGCCTTCTGTAGATAAACCCATACTCGAGTATGGGTTTATCTACAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)