EMAIL THIS PAGE TO A FRIEND

HSF2BP

heat shock transcription factor 2 binding protein

62 Gene Product Result for
UniProtKB ID: O75031
Gene ID:
Human(11077) Summary: HSF2 binding protein (HSF2BP) associates with HSF2. The interaction occurs between the trimerization domain of HSF2 and the amino terminal hydrophilic region of HSF2BP that comprises two leucine zipper motifs. HSF2BP may therefore be involved in modulating HSF2 activation. [provided by RefSeq, Jul 2008]
Mouse(74377) heat shock transcription factor 2 binding protein
Rat(499413) heat shock transcription factor 2 binding protein
Zebrafish(565831) heat shock transcription factor 2 binding protein
cow(617142) heat shock transcription factor 2 binding protein
Horse(100051062) heat shock transcription factor 2 binding protein
domestic cat(101083441) heat shock transcription factor 2 binding protein
dog(611230) heat shock transcription factor 2 binding protein
chicken(418548) heat shock transcription factor 2 binding protein
sheep(101106734) heat shock transcription factor 2 binding protein
domestic guinea pig(100724534) heat shock transcription factor 2 binding protein
naked mole-rat(101700246) heat shock transcription factor 2 binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007031 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007031 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007031 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_484622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007031 Rosetta Predictions human pricing
NM_001127683 Rosetta Predictions rat pricing
XM_484622 Rosetta Predictions mouse pricing
XM_904809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219443 predicted 1086
2 SASI_Hs01_00219444 predicted 898
3 SASI_Hs02_00342805 predicted 981
4 SASI_Hs01_00219445 predicted 929
5 SASI_Hs01_00219446 predicted 1417
6 SASI_Hs01_00219447 predicted 901
7 SASI_Hs02_00342806 predicted 674
8 SASI_Hs02_00342807 predicted 602
9 SASI_Hs01_00219449 predicted 381
10 SASI_Hs01_00219450 predicted 1423
11 SASI_Hs01_00219442 predicted 391
12 SASI_Hs01_00219448 predicted 1055
13 SASI_Hs01_00219451 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254860 predicted 449
2 SASI_Rn02_00254861 predicted 1071
3 SASI_Rn02_00254862 predicted 720
4 SASI_Rn02_00254863 predicted 667
5 SASI_Rn02_00254864 predicted 1018
6 SASI_Rn02_00254865 predicted 688
7 SASI_Rn02_00254866 predicted 853
8 SASI_Rn02_00254867 predicted 803
9 SASI_Rn02_00254868 predicted 1263
10 SASI_Rn02_00254869 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220344 predicted 272
2 SASI_Mm02_00426499 predicted 732
3 SASI_Mm01_00220346 predicted 368
4 SASI_Mm01_00220347 predicted 1138
5 SASI_Mm01_00220348 predicted 1027
6 SASI_Mm02_00426500 predicted 684
7 SASI_Mm01_00220349 predicted 873
8 SASI_Mm01_00220351 predicted 616
9 SASI_Mm01_00220352 predicted 1080
10 SASI_Mm02_00426501 predicted 383
11 SASI_Mm01_00220343 predicted 1124
12 SASI_Mm01_00220345 predicted 1210
13 SASI_Mm01_00220350 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431284 predicted 276
2 SASI_Mm02_00431285 predicted 734
3 SASI_Mm02_00431286 predicted 377
4 SASI_Mm02_00431287 predicted 1135
5 SASI_Mm02_00431288 predicted 1022
6 SASI_Mm02_00431289 predicted 679
7 SASI_Mm02_00431290 predicted 871
8 SASI_Mm02_00431291 predicted 618
9 SASI_Mm02_00431292 predicted 1087
10 SASI_Mm02_00431293 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007031
VALIDATED
HSF2BP MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor 2 binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-891s1c1
Sequence:CCGGGCTGGAATTGTCACGAATGTTCTCGAGAACATTCGTGACAATTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-956s21c1
Sequence:CCGGGGTGCTCTTGGACACCATATTCTCGAGAATATGGTGTCCAAGAGCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-447s1c1
Sequence:CCGGCGGGACTTCTTACCCAGAATACTCGAGTATTCTGGGTAAGAAGTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-1025s1c1
Sequence:CCGGGCTAATGCTGATGTCCCTATACTCGAGTATAGGGACATCAGCATTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_007031.1-862s1c1
Sequence:CCGGCGGATGAAAGTCAGTTTGTTTCTCGAGAAACAAACTGACTTTCATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-602s1c1
Sequence:CCGGCGACAACATAAGAGAGAAGAACTCGAGTTCTTCTCTCTTATGTTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-859s21c1
Sequence:GTACCGGATTCGGATGAAAGTCAGTTTGCTCGAGCAAACTGACTTTCATCCGAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-1311s21c1
Sequence:CCGGCTCCGCACTCTGGAGCATAATCTCGAGATTATGCTCCAGAGTGCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007031.1-1650s21c1
Sequence:CCGGACCTGTAGGTTCACCTATAAACTCGAGTTTATAGGTGAACCTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-363s21c1
Sequence:CCGGTGCCGGCACATGGGAACTAAACTCGAGTTTAGTTCCCATGTGCCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007031
VALIDATED
HSF2BP MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor 2 binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-891s1c1
Sequence:CCGGGCTGGAATTGTCACGAATGTTCTCGAGAACATTCGTGACAATTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-956s21c1
Sequence:CCGGGGTGCTCTTGGACACCATATTCTCGAGAATATGGTGTCCAAGAGCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-447s1c1
Sequence:CCGGCGGGACTTCTTACCCAGAATACTCGAGTATTCTGGGTAAGAAGTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-1025s1c1
Sequence:CCGGGCTAATGCTGATGTCCCTATACTCGAGTATAGGGACATCAGCATTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_007031.1-862s1c1
Sequence:CCGGCGGATGAAAGTCAGTTTGTTTCTCGAGAAACAAACTGACTTTCATCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-602s1c1
Sequence:CCGGCGACAACATAAGAGAGAAGAACTCGAGTTCTTCTCTCTTATGTTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-859s21c1
Sequence:GTACCGGATTCGGATGAAAGTCAGTTTGCTCGAGCAAACTGACTTTCATCCGAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-1311s21c1
Sequence:CCGGCTCCGCACTCTGGAGCATAATCTCGAGATTATGCTCCAGAGTGCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007031.1-1650s21c1
Sequence:CCGGACCTGTAGGTTCACCTATAAACTCGAGTTTATAGGTGAACCTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-363s21c1
Sequence:CCGGTGCCGGCACATGGGAACTAAACTCGAGTTTAGTTCCCATGTGCCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007031
VALIDATED
HSF2BP MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor 2 binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-891s1c1
Sequence:CCGGGCTGGAATTGTCACGAATGTTCTCGAGAACATTCGTGACAATTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-956s21c1
Sequence:CCGGGGTGCTCTTGGACACCATATTCTCGAGAATATGGTGTCCAAGAGCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-447s1c1
Sequence:CCGGCGGGACTTCTTACCCAGAATACTCGAGTATTCTGGGTAAGAAGTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-1025s1c1
Sequence:CCGGGCTAATGCTGATGTCCCTATACTCGAGTATAGGGACATCAGCATTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_007031.1-862s1c1
Sequence:CCGGCGGATGAAAGTCAGTTTGTTTCTCGAGAAACAAACTGACTTTCATCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007031.1-602s1c1
Sequence:CCGGCGACAACATAAGAGAGAAGAACTCGAGTTCTTCTCTCTTATGTTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-859s21c1
Sequence:GTACCGGATTCGGATGAAAGTCAGTTTGCTCGAGCAAACTGACTTTCATCCGAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-1311s21c1
Sequence:CCGGCTCCGCACTCTGGAGCATAATCTCGAGATTATGCTCCAGAGTGCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229707    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007031.1-1650s21c1
Sequence:CCGGACCTGTAGGTTCACCTATAAACTCGAGTTTATAGGTGAACCTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007031.1-363s21c1
Sequence:CCGGTGCCGGCACATGGGAACTAAACTCGAGTTTAGTTCCCATGTGCCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484622
HSF2BP MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor 2 binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-739s21c1
Sequence:CCGGGTATAATGTGAGCATCAATTCCTCGAGGAATTGATGCTCACATTATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-121s21c1
Sequence:CCGGGACGACGGAAGTGATGCAAATCTCGAGATTTGCATCACTTCCGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-59s21c1
Sequence:CCGGTGCCGGAACATGGAATCTAAACTCGAGTTTAGATTCCATGTTCCGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_484622.4-1853s21c1
Sequence:CCGGGCGGCAGGAGATGTCCATTTACTCGAGTAAATGGACATCTCCTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-538s21c1
Sequence:CCGGGGATGTCAAGGAGGTTGATTCCTCGAGGAATCAACCTCCTTGACATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484622
HSF2BP MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor 2 binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-739s21c1
Sequence:CCGGGTATAATGTGAGCATCAATTCCTCGAGGAATTGATGCTCACATTATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-121s21c1
Sequence:CCGGGACGACGGAAGTGATGCAAATCTCGAGATTTGCATCACTTCCGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-59s21c1
Sequence:CCGGTGCCGGAACATGGAATCTAAACTCGAGTTTAGATTCCATGTTCCGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_484622.4-1853s21c1
Sequence:CCGGGCGGCAGGAGATGTCCATTTACTCGAGTAAATGGACATCTCCTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-538s21c1
Sequence:CCGGGGATGTCAAGGAGGTTGATTCCTCGAGGAATCAACCTCCTTGACATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484622
HSF2BP MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor 2 binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-739s21c1
Sequence:CCGGGTATAATGTGAGCATCAATTCCTCGAGGAATTGATGCTCACATTATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-121s21c1
Sequence:CCGGGACGACGGAAGTGATGCAAATCTCGAGATTTGCATCACTTCCGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-59s21c1
Sequence:CCGGTGCCGGAACATGGAATCTAAACTCGAGTTTAGATTCCATGTTCCGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239567    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_484622.4-1853s21c1
Sequence:CCGGGCGGCAGGAGATGTCCATTTACTCGAGTAAATGGACATCTCCTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_484622.4-538s21c1
Sequence:CCGGGGATGTCAAGGAGGTTGATTCCTCGAGGAATCAACCTCCTTGACATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)