EMAIL THIS PAGE TO A FRIEND

HSF4

heat shock transcription factor 4

151 Gene Product Result for
Synonyms: CTM CTRCT5
UniProtKB ID: Q9ULV5, Q99472, Q9ULV6
Gene ID:
Human(3299) Summary: Heat-shock transcription factors (HSFs) activate heat-shock response genes under conditions of heat or other stresses. HSF4 lacks the carboxyl-terminal hydrophobic repeat which is shared among all vertebrate HSFs and has been suggested to be involved in the negative regulation of DNA binding activity. Two alternatively spliced transcripts encoding distinct isoforms and possessing different transcriptional activity have been described. [provided by RefSeq, Jul 2008]
Mouse(26386) heat shock transcription factor 4
Rat(291960) heat shock transcription factor 4
Zebrafish(503739) heat shock transcription factor 4
Thale Cress(829853) heat stress transcription factor B-1
domestic cat(101087799) heat shock transcription factor 4
cow(614788) heat shock transcription factor 4
Horse(100052978) heat shock transcription factor 4
dog(489766) heat shock transcription factor 4
chicken(427540) heat shock transcription factor 4
sheep(101110783) heat shock transcription factor 4
domestic guinea pig(100712840) heat shock transcription factor 4
naked mole-rat(101720625) heat shock transcription factor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001538 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040667 Rosetta Predictions human pricing
NM_001538 Rosetta Predictions human pricing
NM_001106177 Rosetta Predictions rat pricing
NM_011939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079834 predicted 1104
2 SASI_Hs01_00079835 predicted 2300
3 SASI_Hs01_00079836 predicted 2115
4 SASI_Hs01_00079837 predicted 1024
5 SASI_Hs01_00079838 predicted 1075
6 SASI_Hs01_00079839 predicted 1109
7 SASI_Hs01_00079840 predicted 1098
8 SASI_Hs01_00079841 predicted 991
9 SASI_Hs01_00079842 predicted 1102
10 SASI_Hs01_00079843 predicted 2101
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071873 predicted 1103
2 SASI_Hs01_00071874 predicted 2202
3 SASI_Hs01_00071875 predicted 2023
4 SASI_Hs01_00071876 predicted 1020
5 SASI_Hs01_00071877 predicted 1075
6 SASI_Hs01_00071878 predicted 1115
7 SASI_Hs01_00071879 predicted 1101
8 SASI_Hs01_00071880 predicted 985
9 SASI_Hs01_00071881 predicted 1104
10 SASI_Hs01_00071882 predicted 2018
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106177 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216388 predicted 1154
2 SASI_Rn02_00216389 predicted 215
3 SASI_Rn02_00216390 predicted 501
4 SASI_Rn02_00216391 predicted 572
5 SASI_Rn02_00216392 predicted 525
6 SASI_Rn02_00216393 predicted 558
7 SASI_Rn02_00216394 predicted 1071
8 SASI_Rn02_00216395 predicted 1270
9 SASI_Rn02_00216396 predicted 1224
10 SASI_Rn02_00216397 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190570 predicted 1209
2 SASI_Mm01_00190571 predicted 382
3 SASI_Mm01_00190572 predicted 569
4 SASI_Mm01_00190573 predicted 647
5 SASI_Mm01_00190574 predicted 1172
6 SASI_Mm01_00190575 predicted 420
7 SASI_Mm01_00190576 predicted 938
8 SASI_Mm01_00190577 predicted 497
9 SASI_Mm01_00190578 predicted 396
10 SASI_Mm02_00321793 predicted 253
11 SASI_Mm01_00190569 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011939
VALIDATED
HSF4 MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-1119s1c1
Sequence:CCGGTGGACGAGAATGGACCTTGATCTCGAGATCAAGGTCCATTCTCGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-651s1c1
Sequence:CCGGCGCCTGTTCAGCATCTGCCAACTCGAGTTGGCAGATGCTGAACAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-1201s1c1
Sequence:CCGGCTGACGGTCAAGGAGTTGAATCTCGAGATTCAACTCCTTGACCGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-713s1c1
Sequence:CCGGCCTACTTTATCCAGTCGCCTTCTCGAGAAGGCGACTGGATAAAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011939.1-289s1c1
Sequence:CCGGGACCACGTTGAGTTTCAGCATCTCGAGATGCTGAAACTCAACGTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-284s21c1
Sequence:CCGGAGCGTGACCACGTTGAGTTTCCTCGAGGAAACTCAACGTGGTCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-655s21c1
Sequence:CCGGTGTTCAGCATCTGCCAAATTCCTCGAGGAATTTGGCAGATGCTGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-1266s21c1
Sequence:CCGGGCTAGATGTCCAGGCGGATTTCTCGAGAAATCCGCCTGGACATCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-130s21c1
Sequence:CCGGACCAGCTTCCTCGTAAGTGATCTCGAGATCACTTACGAGGAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-624s21c1
Sequence:CCGGACTGTCCCTAATGCTAGATGACTCGAGTCATCTAGCATTAGGGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-481s21c1
Sequence:CCGGAGGCAGCAGAACGAGATCTTGCTCGAGCAAGATCTCGTTCTGCTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-214s21c1
Sequence:CCGGGTTCGCCAACTCAACATGTATCTCGAGATACATGTTGAGTTGGCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-560s21c1
Sequence:CCGGAGCTAATCCAGTGCCTGTTTGCTCGAGCAAACAGGCACTGGATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011939
VALIDATED
HSF4 MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-1119s1c1
Sequence:CCGGTGGACGAGAATGGACCTTGATCTCGAGATCAAGGTCCATTCTCGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-651s1c1
Sequence:CCGGCGCCTGTTCAGCATCTGCCAACTCGAGTTGGCAGATGCTGAACAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-1201s1c1
Sequence:CCGGCTGACGGTCAAGGAGTTGAATCTCGAGATTCAACTCCTTGACCGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-713s1c1
Sequence:CCGGCCTACTTTATCCAGTCGCCTTCTCGAGAAGGCGACTGGATAAAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011939.1-289s1c1
Sequence:CCGGGACCACGTTGAGTTTCAGCATCTCGAGATGCTGAAACTCAACGTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-284s21c1
Sequence:CCGGAGCGTGACCACGTTGAGTTTCCTCGAGGAAACTCAACGTGGTCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-655s21c1
Sequence:CCGGTGTTCAGCATCTGCCAAATTCCTCGAGGAATTTGGCAGATGCTGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-1266s21c1
Sequence:CCGGGCTAGATGTCCAGGCGGATTTCTCGAGAAATCCGCCTGGACATCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-130s21c1
Sequence:CCGGACCAGCTTCCTCGTAAGTGATCTCGAGATCACTTACGAGGAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-624s21c1
Sequence:CCGGACTGTCCCTAATGCTAGATGACTCGAGTCATCTAGCATTAGGGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-481s21c1
Sequence:CCGGAGGCAGCAGAACGAGATCTTGCTCGAGCAAGATCTCGTTCTGCTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-214s21c1
Sequence:CCGGGTTCGCCAACTCAACATGTATCTCGAGATACATGTTGAGTTGGCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-560s21c1
Sequence:CCGGAGCTAATCCAGTGCCTGTTTGCTCGAGCAAACAGGCACTGGATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011939
VALIDATED
HSF4 MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-1119s1c1
Sequence:CCGGTGGACGAGAATGGACCTTGATCTCGAGATCAAGGTCCATTCTCGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-651s1c1
Sequence:CCGGCGCCTGTTCAGCATCTGCCAACTCGAGTTGGCAGATGCTGAACAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-1201s1c1
Sequence:CCGGCTGACGGTCAAGGAGTTGAATCTCGAGATTCAACTCCTTGACCGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011939.1-713s1c1
Sequence:CCGGCCTACTTTATCCAGTCGCCTTCTCGAGAAGGCGACTGGATAAAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011939.1-289s1c1
Sequence:CCGGGACCACGTTGAGTTTCAGCATCTCGAGATGCTGAAACTCAACGTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-284s21c1
Sequence:CCGGAGCGTGACCACGTTGAGTTTCCTCGAGGAAACTCAACGTGGTCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-655s21c1
Sequence:CCGGTGTTCAGCATCTGCCAAATTCCTCGAGGAATTTGGCAGATGCTGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-1266s21c1
Sequence:CCGGGCTAGATGTCCAGGCGGATTTCTCGAGAAATCCGCCTGGACATCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-130s21c1
Sequence:CCGGACCAGCTTCCTCGTAAGTGATCTCGAGATCACTTACGAGGAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-624s21c1
Sequence:CCGGACTGTCCCTAATGCTAGATGACTCGAGTCATCTAGCATTAGGGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-481s21c1
Sequence:CCGGAGGCAGCAGAACGAGATCTTGCTCGAGCAAGATCTCGTTCTGCTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-214s21c1
Sequence:CCGGGTTCGCCAACTCAACATGTATCTCGAGATACATGTTGAGTTGGCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011939.2-560s21c1
Sequence:CCGGAGCTAATCCAGTGCCTGTTTGCTCGAGCAAACAGGCACTGGATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001538
HSF4 MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001538.1-1404s1c1
Sequence:CCGGCGCCTCTGAAGGGGCTTGGAACTCGAGTTCCAAGCCCCTTCAGAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001538.1-1116s1c1
Sequence:CCGGCCAGTCTCCAAGGGCGAGAATCTCGAGATTCTCGCCCTTGGAGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001538.1-226s1c1
Sequence:CCGGCCAACTCAACATGTACGGTTTCTCGAGAAACCGTACATGTTGAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001538.3-2113s21c1
Sequence:CCGGACATGGAGCTGTCCTTGATGCCTCGAGGCATCAAGGACAGCTCCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001538.3-1762s21c1
Sequence:CCGGCATCTCTGACATCCCAGAAGACTCGAGTCTTCTGGGATGTCAGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001538.3-1717s21c1
Sequence:CCGGAGAGACAAATTTGGGCCTTAGCTCGAGCTAAGGCCCAAATTTGTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001538
HSF4 MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001538.1-1404s1c1
Sequence:CCGGCGCCTCTGAAGGGGCTTGGAACTCGAGTTCCAAGCCCCTTCAGAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001538.1-1116s1c1
Sequence:CCGGCCAGTCTCCAAGGGCGAGAATCTCGAGATTCTCGCCCTTGGAGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001538.1-226s1c1
Sequence:CCGGCCAACTCAACATGTACGGTTTCTCGAGAAACCGTACATGTTGAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001538.3-2113s21c1
Sequence:CCGGACATGGAGCTGTCCTTGATGCCTCGAGGCATCAAGGACAGCTCCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001538.3-1762s21c1
Sequence:CCGGCATCTCTGACATCCCAGAAGACTCGAGTCTTCTGGGATGTCAGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001538.3-1717s21c1
Sequence:CCGGAGAGACAAATTTGGGCCTTAGCTCGAGCTAAGGCCCAAATTTGTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001538
HSF4 MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001538.1-1404s1c1
Sequence:CCGGCGCCTCTGAAGGGGCTTGGAACTCGAGTTCCAAGCCCCTTCAGAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001538.1-1116s1c1
Sequence:CCGGCCAGTCTCCAAGGGCGAGAATCTCGAGATTCTCGCCCTTGGAGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001538.1-226s1c1
Sequence:CCGGCCAACTCAACATGTACGGTTTCTCGAGAAACCGTACATGTTGAGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001538.3-2113s21c1
Sequence:CCGGACATGGAGCTGTCCTTGATGCCTCGAGGCATCAAGGACAGCTCCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001538.3-1762s21c1
Sequence:CCGGCATCTCTGACATCCCAGAAGACTCGAGTCTTCTGGGATGTCAGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001538.3-1717s21c1
Sequence:CCGGAGAGACAAATTTGGGCCTTAGCTCGAGCTAAGGCCCAAATTTGTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)