EMAIL THIS PAGE TO A FRIEND

HSF5

heat shock transcription factor family member 5

186 Gene Product Result for
Synonyms: HSF 5 HSTF 5
UniProtKB ID: Q4G112, Q08EH7, Q8N7V2
Gene ID:
Mouse(327992) heat shock transcription factor family member 5
Rat(688111) heat shock transcription factor family member 5
domestic guinea pig(100718844) heat shock transcription factor family member 5
naked mole-rat(101711673) heat shock transcription factor family member 5
sheep(101105087) heat shock transcription factor family member 5
Zebrafish(100004222) heat shock transcription factor family member 5
cow(784069) heat shock transcription factor family member 5
domestic cat(101082863) heat shock transcription factor family member 5
dog(610000) heat shock transcription factor family member 5
chicken(417471) heat shock transcription factor family member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001045527 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045527 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045527 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_064190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_064190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_064190 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080439 Rosetta Predictions human pricing
XM_064190 Rosetta Predictions human pricing
XM_001081169 Rosetta Predictions rat pricing
NM_001045527 Rosetta Predictions mouse pricing
XM_282974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314856 predicted 1158
2 SASI_Hs02_00314857 predicted 1321
3 SASI_Hs02_00314858 predicted 1714
4 SASI_Hs02_00314859 predicted 1078
5 SASI_Hs02_00314860 predicted 1329
6 SASI_Hs02_00314861 predicted 939
7 SASI_Hs02_00314862 predicted 1332
8 SASI_Hs02_00314863 predicted 1091
9 SASI_Hs02_00314864 predicted 1069
10 SASI_Hs02_00314865 predicted 1777
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_064190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299656 predicted 1579
2 SASI_Hs01_00299657 predicted 1306
3 SASI_Hs01_00299658 predicted 1708
4 SASI_Hs01_00299659 predicted 1782
5 SASI_Hs01_00299660 predicted 1322
6 SASI_Hs01_00299661 predicted 1319
7 SASI_Hs01_00299662 predicted 1675
8 SASI_Hs01_00299663 predicted 1710
9 SASI_Hs01_00299664 predicted 1767
10 SASI_Hs01_00299665 predicted 1418
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00370881 predicted 1153
2 SASI_Rn02_00370882 predicted 1562
3 SASI_Rn02_00370883 predicted 1767
4 SASI_Rn02_00370884 predicted 1113
5 SASI_Rn02_00370885 predicted 1573
6 SASI_Rn02_00370886 predicted 1774
7 SASI_Rn02_00370887 predicted 1694
8 SASI_Rn02_00370888 predicted 1372
9 SASI_Rn02_00370889 predicted 1317
10 SASI_Rn02_00370890 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291624 predicted 1208
2 SASI_Mm02_00291625 predicted 1770
3 SASI_Mm02_00291626 predicted 1223
4 SASI_Mm02_00291627 predicted 959
5 SASI_Mm02_00291628 predicted 1342
6 SASI_Mm02_00291629 predicted 1185
7 SASI_Mm02_00291630 predicted 1420
8 SASI_Mm02_00291631 predicted 1828
9 SASI_Mm02_00291632 predicted 1250
10 SASI_Mm02_00291633 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_282974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223442 predicted 251
2 SASI_Mm01_00223443 predicted 233
3 SASI_Mm01_00223444 predicted 294
4 SASI_Mm01_00223445 predicted 222
5 SASI_Mm01_00223446 predicted 225
6 SASI_Mm01_00223447 predicted 294
7 SASI_Mm01_00223448 predicted 264
8 SASI_Mm01_00223449 predicted 287
9 SASI_Mm01_00223450 predicted 239
10 SASI_Mm01_00223451 predicted 229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045527
HSF5 MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor family member 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045527.1-2801s21c1
Sequence:CCGGTTGCAGAGTGGAAGGATTAAACTCGAGTTTAATCCTTCCACTCTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-1091s21c1
Sequence:CCGGAGTACTCCCAAGCCTACTATCCTCGAGGATAGTAGGCTTGGGAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-1685s21c1
Sequence:CCGGCTCCGTCTTCAGTAGTATTTGCTCGAGCAAATACTACTGAAGACGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-769s21c1
Sequence:CCGGCGGTCATTCCGGCGAGATAATCTCGAGATTATCTCGCCGGAATGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-1956s21c1
Sequence:CCGGCCCAAAGGAGGAGGAGTTAAACTCGAGTTTAACTCCTCCTCCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045527
HSF5 MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor family member 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045527.1-2801s21c1
Sequence:CCGGTTGCAGAGTGGAAGGATTAAACTCGAGTTTAATCCTTCCACTCTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-1091s21c1
Sequence:CCGGAGTACTCCCAAGCCTACTATCCTCGAGGATAGTAGGCTTGGGAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-1685s21c1
Sequence:CCGGCTCCGTCTTCAGTAGTATTTGCTCGAGCAAATACTACTGAAGACGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-769s21c1
Sequence:CCGGCGGTCATTCCGGCGAGATAATCTCGAGATTATCTCGCCGGAATGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-1956s21c1
Sequence:CCGGCCCAAAGGAGGAGGAGTTAAACTCGAGTTTAACTCCTCCTCCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045527
HSF5 MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor family member 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045527.1-2801s21c1
Sequence:CCGGTTGCAGAGTGGAAGGATTAAACTCGAGTTTAATCCTTCCACTCTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-1091s21c1
Sequence:CCGGAGTACTCCCAAGCCTACTATCCTCGAGGATAGTAGGCTTGGGAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-1685s21c1
Sequence:CCGGCTCCGTCTTCAGTAGTATTTGCTCGAGCAAATACTACTGAAGACGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-769s21c1
Sequence:CCGGCGGTCATTCCGGCGAGATAATCTCGAGATTATCTCGCCGGAATGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045527.1-1956s21c1
Sequence:CCGGCCCAAAGGAGGAGGAGTTAAACTCGAGTTTAACTCCTCCTCCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_064190
HSF5 MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor family member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1230s1c1
Sequence:CCGGGCTGTCTTTCAGATAGTTGATCTCGAGATCAACTATCTGAAAGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1113s1c1
Sequence:CCGGCACTGCAACTACTTCCAGAATCTCGAGATTCTGGAAGTAGTTGCAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-746s1c1
Sequence:CCGGCCACAGTACTTACCCTCTGAACTCGAGTTCAGAGGGTAAGTACTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1752s1c1
Sequence:CCGGCCTAGTGAAGACACAGGTTTACTCGAGTAAACCTGTGTCTTCACTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1869s1c1
Sequence:CCGGCGCTTTCCAAAGGAGGAAGAACTCGAGTTCTTCCTCCTTTGGAAAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_064190
HSF5 MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor family member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1230s1c1
Sequence:CCGGGCTGTCTTTCAGATAGTTGATCTCGAGATCAACTATCTGAAAGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1113s1c1
Sequence:CCGGCACTGCAACTACTTCCAGAATCTCGAGATTCTGGAAGTAGTTGCAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-746s1c1
Sequence:CCGGCCACAGTACTTACCCTCTGAACTCGAGTTCAGAGGGTAAGTACTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1752s1c1
Sequence:CCGGCCTAGTGAAGACACAGGTTTACTCGAGTAAACCTGTGTCTTCACTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1869s1c1
Sequence:CCGGCGCTTTCCAAAGGAGGAAGAACTCGAGTTCTTCCTCCTTTGGAAAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_064190
HSF5 MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor family member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1230s1c1
Sequence:CCGGGCTGTCTTTCAGATAGTTGATCTCGAGATCAACTATCTGAAAGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1113s1c1
Sequence:CCGGCACTGCAACTACTTCCAGAATCTCGAGATTCTGGAAGTAGTTGCAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-746s1c1
Sequence:CCGGCCACAGTACTTACCCTCTGAACTCGAGTTCAGAGGGTAAGTACTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1752s1c1
Sequence:CCGGCCTAGTGAAGACACAGGTTTACTCGAGTAAACCTGTGTCTTCACTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_064190.3-1869s1c1
Sequence:CCGGCGCTTTCCAAAGGAGGAAGAACTCGAGTTCTTCCTCCTTTGGAAAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)