EMAIL THIS PAGE TO A FRIEND

HSFY1

heat shock transcription factor, Y-linked 1

48 Gene Product Result for
Synonyms: HSF2L HSFY
Species: Human HSFY1(86614), domestic cat HSFY1(677872)
UniProtKB ID: Q96LI6, Q17RC0, Q7Z4L8, Q9BZA2, Q9BZA3
Gene ID:
Human(86614) Summary: This gene encodes a member of the heat shock factor (HSF) family of transcriptional activators for heat shock proteins. This gene is a candidate gene for azoospermia, since it localizes to a region of chromosome Y that is sometimes deleted in infertile males. The genome has two identical copies of this gene within a palindromic region; this record represents the more centromeric copy. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
domestic cat(677872) heat shock transcription factor, Y-linked 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033108 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001871 Rosetta Predictions human pricing
NM_033108 Rosetta Predictions human pricing
NM_152584 Rosetta Predictions human pricing
NR_003510 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184372 predicted 205
2 SASI_Hs01_00184373 predicted 375
3 SASI_Hs01_00184374 predicted 214
4 SASI_Hs01_00184375 predicted 255
5 SASI_Hs01_00184376 predicted 283
6 SASI_Hs01_00184377 predicted 217
7 SASI_Hs01_00184378 predicted 210
8 SASI_Hs01_00184379 predicted 253
9 SASI_Hs01_00184380 predicted 212
10 SASI_Hs01_00184381 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134300 predicted 202
2 SASI_Hs01_00134302 predicted 210
3 SASI_Hs01_00134303 predicted 254
4 SASI_Hs01_00134304 predicted 282
5 SASI_Hs02_00360825 predicted 376
6 SASI_Hs01_00134305 predicted 218
7 SASI_Hs01_00134306 predicted 200
8 SASI_Hs01_00134307 predicted 255
9 SASI_Hs01_00134308 predicted 202
10 SASI_Hs01_00134309 predicted 209
11 SASI_Hs01_00134301 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189128 predicted 197
2 SASI_Hs01_00189130 predicted 213
3 SASI_Hs01_00189131 predicted 250
4 SASI_Hs01_00189132 predicted 283
5 SASI_Hs02_00366406 predicted 371
6 SASI_Hs01_00189133 predicted 214
7 SASI_Hs01_00189134 predicted 196
8 SASI_Hs01_00189135 predicted 256
9 SASI_Hs01_00189136 predicted 201
10 SASI_Hs01_00189137 predicted 211
11 SASI_Hs01_00189129 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003510 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379377 predicted 193
2 SASI_Hs02_00379378 predicted 582
3 SASI_Hs02_00379379 predicted 628
4 SASI_Hs02_00379380 predicted 208
5 SASI_Hs02_00379381 predicted 251
6 SASI_Hs02_00379382 predicted 589
7 SASI_Hs02_00379383 predicted 583
8 SASI_Hs02_00379384 predicted 494
9 SASI_Hs02_00379385 predicted 585
10 SASI_Hs02_00379386 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033108
HSFY1 MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor, Y-linked 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-362s1c1
Sequence:CCGGGAAAGTGACCAATTCAGTCTTCTCGAGAAGACTGAATTGGTCACTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-1000s1c1
Sequence:CCGGGCACTCTCATAGTACCTACATCTCGAGATGTAGGTACTATGAGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-568s1c1
Sequence:CCGGCACCTTTCTGTCAGAAGAGATCTCGAGATCTCTTCTGACAGAAAGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-258s1c1
Sequence:CCGGGATCCTTGTTAGAAAGTCCAACTCGAGTTGGACTTTCTAACAAGGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-135s1c1
Sequence:CCGGCCAAAGATGAATTAACTGCTTCTCGAGAAGCAGTTAATTCATCTTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033108.2-369s21c1
Sequence:CCGGGTGACCAATTCAAGTCTATTTCTCGAGAAATAGACTTGAATTGGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033108.2-206s21c1
Sequence:CCGGGACTCAGACTTACGGTCAATGCTCGAGCATTGACCGTAAGTCTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033108.2-598s21c1
Sequence:CCGGGTCTGTCTTAAGCAAGTTAAACTCGAGTTTAACTTGCTTAAGACAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033108
HSFY1 MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor, Y-linked 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-362s1c1
Sequence:CCGGGAAAGTGACCAATTCAGTCTTCTCGAGAAGACTGAATTGGTCACTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-1000s1c1
Sequence:CCGGGCACTCTCATAGTACCTACATCTCGAGATGTAGGTACTATGAGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-568s1c1
Sequence:CCGGCACCTTTCTGTCAGAAGAGATCTCGAGATCTCTTCTGACAGAAAGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-258s1c1
Sequence:CCGGGATCCTTGTTAGAAAGTCCAACTCGAGTTGGACTTTCTAACAAGGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-135s1c1
Sequence:CCGGCCAAAGATGAATTAACTGCTTCTCGAGAAGCAGTTAATTCATCTTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033108.2-369s21c1
Sequence:CCGGGTGACCAATTCAAGTCTATTTCTCGAGAAATAGACTTGAATTGGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033108.2-206s21c1
Sequence:CCGGGACTCAGACTTACGGTCAATGCTCGAGCATTGACCGTAAGTCTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033108.2-598s21c1
Sequence:CCGGGTCTGTCTTAAGCAAGTTAAACTCGAGTTTAACTTGCTTAAGACAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033108
HSFY1 MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor, Y-linked 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-362s1c1
Sequence:CCGGGAAAGTGACCAATTCAGTCTTCTCGAGAAGACTGAATTGGTCACTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-1000s1c1
Sequence:CCGGGCACTCTCATAGTACCTACATCTCGAGATGTAGGTACTATGAGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-568s1c1
Sequence:CCGGCACCTTTCTGTCAGAAGAGATCTCGAGATCTCTTCTGACAGAAAGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-258s1c1
Sequence:CCGGGATCCTTGTTAGAAAGTCCAACTCGAGTTGGACTTTCTAACAAGGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033108.1-135s1c1
Sequence:CCGGCCAAAGATGAATTAACTGCTTCTCGAGAAGCAGTTAATTCATCTTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033108.2-369s21c1
Sequence:CCGGGTGACCAATTCAAGTCTATTTCTCGAGAAATAGACTTGAATTGGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033108.2-206s21c1
Sequence:CCGGGACTCAGACTTACGGTCAATGCTCGAGCATTGACCGTAAGTCTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033108.2-598s21c1
Sequence:CCGGGTCTGTCTTAAGCAAGTTAAACTCGAGTTTAACTTGCTTAAGACAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)