EMAIL THIS PAGE TO A FRIEND

HSFY2

heat shock transcription factor, Y linked 2

108 Gene Product Result for
Synonyms: HSF2L HSFY
Gene ID:
Human(159119) Summary: This gene encodes a member of the heat shock factor (HSF) family of transcriptional activators for heat shock proteins. This gene is a candidate gene for azoospermia, since it localizes to a region of chromosome Y that is sometimes deleted in infertile males. The genome has two identical copies of this gene within a palindromic region; this record represents the more telomeric copy. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(71066) heat shock transcription factor, Y linked 2
Rat(316409) heat shock transcription factor, Y linked 2
cow(767933) heat shock transcription factor, Y linked 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV37380 Anti-HSFY2 antibody produced in rabbit IgG fraction of antiserum rat, human, mouse
western blot pricing
SAB1402031 Monoclonal Anti-HSFY2 antibody produced in mouse clone 4B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153716 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_129825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_129825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_129825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114361 MISSION® esiRNA esiRNA human HSFY1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001877 Rosetta Predictions human pricing
NM_001001878 Rosetta Predictions human pricing
NM_153716 Rosetta Predictions human pricing
NR_003509 Rosetta Predictions human pricing
NM_001012132 Rosetta Predictions rat pricing
XM_576569 Rosetta Predictions rat pricing
NM_027661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176770 predicted 198
2 SASI_Hs01_00176772 predicted 209
3 SASI_Hs01_00176773 predicted 248
4 SASI_Hs01_00176774 predicted 284
5 SASI_Hs02_00303967 predicted 376
6 SASI_Hs01_00176775 predicted 214
7 SASI_Hs01_00176776 predicted 202
8 SASI_Hs01_00176777 predicted 253
9 SASI_Hs01_00176778 predicted 205
10 SASI_Hs01_00176779 predicted 205
11 SASI_Hs01_00176771 predicted 380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136694 predicted 202
2 SASI_Hs01_00136695 predicted 373
3 SASI_Hs01_00136696 predicted 212
4 SASI_Hs01_00136697 predicted 247
5 SASI_Hs01_00136698 predicted 292
6 SASI_Hs01_00136699 predicted 221
7 SASI_Hs01_00136700 predicted 202
8 SASI_Hs01_00136701 predicted 256
9 SASI_Hs01_00136702 predicted 210
10 SASI_Hs01_00136703 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086046 predicted 221
2 SASI_Hs01_00086048 predicted 233
3 SASI_Hs01_00086049 predicted 265
4 SASI_Hs01_00086050 predicted 299
5 SASI_Hs02_00367444 predicted 399
6 SASI_Hs01_00086051 predicted 226
7 SASI_Hs01_00086052 predicted 219
8 SASI_Hs01_00086053 predicted 274
9 SASI_Hs01_00086054 predicted 223
10 SASI_Hs01_00086055 predicted 226
11 SASI_Hs01_00086047 predicted 398
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379367 predicted 215
2 SASI_Hs02_00379368 predicted 601
3 SASI_Hs02_00379369 predicted 648
4 SASI_Hs02_00379370 predicted 231
5 SASI_Hs02_00379371 predicted 270
6 SASI_Hs02_00379372 predicted 607
7 SASI_Hs02_00379373 predicted 597
8 SASI_Hs02_00379374 predicted 519
9 SASI_Hs02_00379375 predicted 607
10 SASI_Hs02_00379376 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051434 predicted 381
2 SASI_Rn01_00051435 predicted 1063
3 SASI_Rn01_00051436 predicted 804
4 SASI_Rn01_00051437 predicted 1140
5 SASI_Rn01_00051438 predicted 1004
6 SASI_Rn01_00051439 predicted 1078
7 SASI_Rn01_00051440 predicted 995
8 SASI_Rn01_00051441 predicted 862
9 SASI_Rn02_00200299 predicted 289
10 SASI_Rn01_00051442 predicted 1187
11 SASI_Rn01_00051443 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576569 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00133887 predicted 1180
2 SASI_Rn01_00133888 predicted 1189
3 SASI_Rn01_00133889 predicted 390
4 SASI_Rn01_00133890 predicted 1177
5 SASI_Rn01_00133891 predicted 379
6 SASI_Rn01_00133892 predicted 1106
7 SASI_Rn01_00133893 predicted 386
8 SASI_Rn01_00133894 predicted 1181
9 SASI_Rn01_00133895 predicted 1112
10 SASI_Rn01_00133896 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164545 predicted 910
2 SASI_Mm01_00164546 predicted 377
3 SASI_Mm01_00164547 predicted 775
4 SASI_Mm01_00164548 predicted 1055
5 SASI_Mm01_00164550 predicted 1128
6 SASI_Mm01_00164551 predicted 855
7 SASI_Mm01_00164552 predicted 477
8 SASI_Mm01_00164553 predicted 858
9 SASI_Mm01_00164554 predicted 783
10 SASI_Mm02_00332542 predicted 1135
11 SASI_Mm01_00164549 predicted 1175
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153716
HSFY2 MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor, Y linked 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-283s21c1
Sequence:CCGGTTGTTAGAAAGTCCAAGTTACCTCGAGGTAACTTGGACTTTCTAACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-520s21c1
Sequence:CCGGGTTCGACAGCTCAACCTTTATCTCGAGATAAAGGTTGAGCTGTCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-235s1c1
Sequence:CCGGCGGTCAATGATTGAAGAACATCTCGAGATGTTCTTCAATCATTGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-775s1c1
Sequence:CCGGGCTAACATGGAGAATCATAATCTCGAGATTATGATTCTCCATGTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-715s1c1
Sequence:CCGGGCTTCACCTATATCTACTTTACTCGAGTAAAGTAGATATAGGTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-1285s1c1
Sequence:CCGGCCATCACCACTGGACAAATATCTCGAGATATTTGTCCAGTGGTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-321s1c1
Sequence:CCGGGCCAGATAAAGATGATGATTTCTCGAGAAATCATCATCTTTATCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-995s21c1
Sequence:CCGGTAAATCAGTTGACCACTATTCCTCGAGGAATAGTGGTCAACTGATTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-813s21c1
Sequence:CCGGAGCTAGTGAAGAAAGTTTATTCTCGAGAATAAACTTTCTTCACTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153716
HSFY2 MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor, Y linked 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-283s21c1
Sequence:CCGGTTGTTAGAAAGTCCAAGTTACCTCGAGGTAACTTGGACTTTCTAACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-520s21c1
Sequence:CCGGGTTCGACAGCTCAACCTTTATCTCGAGATAAAGGTTGAGCTGTCGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-235s1c1
Sequence:CCGGCGGTCAATGATTGAAGAACATCTCGAGATGTTCTTCAATCATTGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-775s1c1
Sequence:CCGGGCTAACATGGAGAATCATAATCTCGAGATTATGATTCTCCATGTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-715s1c1
Sequence:CCGGGCTTCACCTATATCTACTTTACTCGAGTAAAGTAGATATAGGTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-1285s1c1
Sequence:CCGGCCATCACCACTGGACAAATATCTCGAGATATTTGTCCAGTGGTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-321s1c1
Sequence:CCGGGCCAGATAAAGATGATGATTTCTCGAGAAATCATCATCTTTATCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-995s21c1
Sequence:CCGGTAAATCAGTTGACCACTATTCCTCGAGGAATAGTGGTCAACTGATTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-813s21c1
Sequence:CCGGAGCTAGTGAAGAAAGTTTATTCTCGAGAATAAACTTTCTTCACTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153716
HSFY2 MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor, Y linked 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-283s21c1
Sequence:CCGGTTGTTAGAAAGTCCAAGTTACCTCGAGGTAACTTGGACTTTCTAACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-520s21c1
Sequence:CCGGGTTCGACAGCTCAACCTTTATCTCGAGATAAAGGTTGAGCTGTCGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-235s1c1
Sequence:CCGGCGGTCAATGATTGAAGAACATCTCGAGATGTTCTTCAATCATTGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-775s1c1
Sequence:CCGGGCTAACATGGAGAATCATAATCTCGAGATTATGATTCTCCATGTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-715s1c1
Sequence:CCGGGCTTCACCTATATCTACTTTACTCGAGTAAAGTAGATATAGGTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-1285s1c1
Sequence:CCGGCCATCACCACTGGACAAATATCTCGAGATATTTGTCCAGTGGTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153716.1-321s1c1
Sequence:CCGGGCCAGATAAAGATGATGATTTCTCGAGAAATCATCATCTTTATCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-995s21c1
Sequence:CCGGTAAATCAGTTGACCACTATTCCTCGAGGAATAGTGGTCAACTGATTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417402    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153716.1-813s21c1
Sequence:CCGGAGCTAGTGAAGAAAGTTTATTCTCGAGAATAAACTTTCTTCACTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_129825
HSFY2 MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor, Y linked 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-844s1c1
Sequence:CCGGCCTGAAGAAATTCTAACACATCTCGAGATGTGTTAGAATTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-303s1c1
Sequence:CCGGCGGGACTTACATAGTGATCAACTCGAGTTGATCACTATGTAAGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-407s1c1
Sequence:CCGGGACAACTTAATCTGTATGGATCTCGAGATCCATACAGATTAAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-108s1c1
Sequence:CCGGCTCAGACTTATGGGCTATTATCTCGAGATAATAGCCCATAAGTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-720s1c1
Sequence:CCGGGTCCAGCTCTAGTATTTCAAACTCGAGTTTGAAATACTAGAGCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_129825
HSFY2 MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor, Y linked 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-844s1c1
Sequence:CCGGCCTGAAGAAATTCTAACACATCTCGAGATGTGTTAGAATTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-303s1c1
Sequence:CCGGCGGGACTTACATAGTGATCAACTCGAGTTGATCACTATGTAAGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-407s1c1
Sequence:CCGGGACAACTTAATCTGTATGGATCTCGAGATCCATACAGATTAAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-108s1c1
Sequence:CCGGCTCAGACTTATGGGCTATTATCTCGAGATAATAGCCCATAAGTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-720s1c1
Sequence:CCGGGTCCAGCTCTAGTATTTCAAACTCGAGTTTGAAATACTAGAGCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_129825
HSFY2 MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor, Y linked 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-844s1c1
Sequence:CCGGCCTGAAGAAATTCTAACACATCTCGAGATGTGTTAGAATTTCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-303s1c1
Sequence:CCGGCGGGACTTACATAGTGATCAACTCGAGTTGATCACTATGTAAGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-407s1c1
Sequence:CCGGGACAACTTAATCTGTATGGATCTCGAGATCCATACAGATTAAGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-108s1c1
Sequence:CCGGCTCAGACTTATGGGCTATTATCTCGAGATAATAGCCCATAAGTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_129825.2-720s1c1
Sequence:CCGGGTCCAGCTCTAGTATTTCAAACTCGAGTTTGAAATACTAGAGCTGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)