EMAIL THIS PAGE TO A FRIEND

HSH2D

hematopoietic SH2 domain containing

46 Gene Product Result for
Synonyms: ALX HSH2
UniProtKB ID: Q96JZ2, B5ME72, Q6ZNG7
Gene ID:
Human(84941) Summary: T-cell activation requires 2 signals: recognition of antigen by the T-cell receptor (see TCR; MIM 186880) and a costimulatory signal provided primarily by CD28 (MIM 186760) in naive T cells. HSH2 is a target of both of these signaling pathways (Greene et al., 2003 [PubMed 12960172]
Mouse(209488) hematopoietic SH2 domain containing
Rat(100360518) hematopoietic SH2 domain containing
sheep(101117244) hematopoietic SH2 domain containing
domestic guinea pig(100716049) hematopoietic SH2 domain containing
naked mole-rat(101708564) hematopoietic SH2 domain containing
Zebrafish(548337) hematopoietic SH2 domain containing
dog(484852) hematopoietic SH2 domain containing
cow(100848273) hematopoietic SH2 domain containing
domestic cat(101100701) hematopoietic SH2 domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_197944 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197944 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197944 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032855 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032855 Rosetta Predictions human pricing
NM_197944 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101867 predicted 682
2 SASI_Hs01_00101868 predicted 1447
3 SASI_Hs01_00101869 predicted 1439
4 SASI_Hs01_00101870 predicted 1215
5 SASI_Hs01_00101871 predicted 733
6 SASI_Hs01_00101872 predicted 1112
7 SASI_Hs01_00101873 predicted 1206
8 SASI_Hs01_00101874 predicted 1455
9 SASI_Hs01_00101875 predicted 709
10 SASI_Hs01_00101876 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197944 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099168 predicted 446
2 SASI_Mm01_00099169 predicted 230
3 SASI_Mm01_00099170 predicted 236
4 SASI_Mm01_00099171 predicted 465
5 SASI_Mm01_00099172 predicted 222
6 SASI_Mm01_00099173 predicted 666
7 SASI_Mm01_00099174 predicted 674
8 SASI_Mm01_00099175 predicted 447
9 SASI_Mm01_00099176 predicted 685
10 SASI_Mm01_00099177 predicted 491
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197944
HSH2D MISSION shRNA Bacterial Glycerol Stock
hematopoietic SH2 domain containing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197944.1-1068s1c1
Sequence:CCGGGTATTCCTCATCTCTCCTTTACTCGAGTAAAGGAGAGATGAGGAATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-427s1c1
Sequence:CCGGGATCCAGCAAACGTGGACTATCTCGAGATAGTCCACGTTTGCTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-273s1c1
Sequence:CCGGCCGTCACTTCATGGTGAAACTCTCGAGAGTTTCACCATGAAGTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-506s1c1
Sequence:CCGGGAACGGAAGTTCAAAGGTCTTCTCGAGAAGACCTTTGAACTTCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-274s1c1
Sequence:CCGGCGTCACTTCATGGTGAAACTTCTCGAGAAGTTTCACCATGAAGTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197944
HSH2D MISSION shRNA shRNA Plasmid DNA
hematopoietic SH2 domain containing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197944.1-1068s1c1
Sequence:CCGGGTATTCCTCATCTCTCCTTTACTCGAGTAAAGGAGAGATGAGGAATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-427s1c1
Sequence:CCGGGATCCAGCAAACGTGGACTATCTCGAGATAGTCCACGTTTGCTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-273s1c1
Sequence:CCGGCCGTCACTTCATGGTGAAACTCTCGAGAGTTTCACCATGAAGTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-506s1c1
Sequence:CCGGGAACGGAAGTTCAAAGGTCTTCTCGAGAAGACCTTTGAACTTCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-274s1c1
Sequence:CCGGCGTCACTTCATGGTGAAACTTCTCGAGAAGTTTCACCATGAAGTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197944
HSH2D MISSION shRNA Lentiviral Transduction Particles
hematopoietic SH2 domain containing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197944.1-1068s1c1
Sequence:CCGGGTATTCCTCATCTCTCCTTTACTCGAGTAAAGGAGAGATGAGGAATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-427s1c1
Sequence:CCGGGATCCAGCAAACGTGGACTATCTCGAGATAGTCCACGTTTGCTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-273s1c1
Sequence:CCGGCCGTCACTTCATGGTGAAACTCTCGAGAGTTTCACCATGAAGTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-506s1c1
Sequence:CCGGGAACGGAAGTTCAAAGGTCTTCTCGAGAAGACCTTTGAACTTCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197944.1-274s1c1
Sequence:CCGGCGTCACTTCATGGTGAAACTTCTCGAGAAGTTTCACCATGAAGTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032855
HSH2D MISSION shRNA Bacterial Glycerol Stock
hematopoietic SH2 domain containing
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032855.2-780s1c1
Sequence:CCGGGCTCTTGGATGATGGGACTTTCTCGAGAAAGTCCCATCATCCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032855.2-927s1c1
Sequence:CCGGCGTGGATTACGAGGATCTCTTCTCGAGAAGAGATCCTCGTAATCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032855.2-1062s1c1
Sequence:CCGGGATGAACAGAATAACCACCAACTCGAGTTGGTGGTTATTCTGTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032855.2-1704s1c1
Sequence:CCGGCGGGAAATGGAATAAAGATGTCTCGAGACATCTTTATTCCATTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032855.2-922s1c1
Sequence:CCGGGCAAACGTGGATTACGAGGATCTCGAGATCCTCGTAATCCACGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032855.2-1053s1c1
Sequence:CCGGGTCAGCAGAGATGAACAGAATCTCGAGATTCTGTTCATCTCTGCTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032855.2-632s21c1
Sequence:CCGGGGTTCCATGGTGCAATCTCAACTCGAGTTGAGATTGCACCATGGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032855.2-728s21c1
Sequence:CCGGGCTACACACTCTCCTACAAAGCTCGAGCTTTGTAGGAGAGTGTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032855.2-1639s21c1
Sequence:CCGGCTCCTGAATGCCTTAACATTTCTCGAGAAATGTTAAGGCATTCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032855
HSH2D MISSION shRNA shRNA Plasmid DNA
hematopoietic SH2 domain containing
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032855.2-780s1c1
Sequence:CCGGGCTCTTGGATGATGGGACTTTCTCGAGAAAGTCCCATCATCCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032855.2-927s1c1
Sequence:CCGGCGTGGATTACGAGGATCTCTTCTCGAGAAGAGATCCTCGTAATCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032855.2-1062s1c1
Sequence:CCGGGATGAACAGAATAACCACCAACTCGAGTTGGTGGTTATTCTGTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032855.2-1704s1c1
Sequence:CCGGCGGGAAATGGAATAAAGATGTCTCGAGACATCTTTATTCCATTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032855.2-922s1c1
Sequence:CCGGGCAAACGTGGATTACGAGGATCTCGAGATCCTCGTAATCCACGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032855.2-1053s1c1
Sequence:CCGGGTCAGCAGAGATGAACAGAATCTCGAGATTCTGTTCATCTCTGCTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032855.2-632s21c1
Sequence:CCGGGGTTCCATGGTGCAATCTCAACTCGAGTTGAGATTGCACCATGGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032855.2-728s21c1
Sequence:CCGGGCTACACACTCTCCTACAAAGCTCGAGCTTTGTAGGAGAGTGTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032855.2-1639s21c1
Sequence:CCGGCTCCTGAATGCCTTAACATTTCTCGAGAAATGTTAAGGCATTCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032855
HSH2D MISSION shRNA Lentiviral Transduction Particles
hematopoietic SH2 domain containing
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032855.2-780s1c1
Sequence:CCGGGCTCTTGGATGATGGGACTTTCTCGAGAAAGTCCCATCATCCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032855.2-927s1c1
Sequence:CCGGCGTGGATTACGAGGATCTCTTCTCGAGAAGAGATCCTCGTAATCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032855.2-1062s1c1
Sequence:CCGGGATGAACAGAATAACCACCAACTCGAGTTGGTGGTTATTCTGTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129663    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032855.2-1704s1c1
Sequence:CCGGCGGGAAATGGAATAAAGATGTCTCGAGACATCTTTATTCCATTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032855.2-922s1c1
Sequence:CCGGGCAAACGTGGATTACGAGGATCTCGAGATCCTCGTAATCCACGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032855.2-1053s1c1
Sequence:CCGGGTCAGCAGAGATGAACAGAATCTCGAGATTCTGTTCATCTCTGCTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032855.2-632s21c1
Sequence:CCGGGGTTCCATGGTGCAATCTCAACTCGAGTTGAGATTGCACCATGGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032855.2-728s21c1
Sequence:CCGGGCTACACACTCTCCTACAAAGCTCGAGCTTTGTAGGAGAGTGTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032855.2-1639s21c1
Sequence:CCGGCTCCTGAATGCCTTAACATTTCTCGAGAAATGTTAAGGCATTCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)