EMAIL THIS PAGE TO A FRIEND

HSP90AA1

heat shock protein 90kDa alpha (cytosolic), class A member 1

82 Gene Product Result for
Synonyms: EL52 HSP86 HSP89A HSP90A HSP90N HSPC1 HSPCA HSPCAL1 HSPCAL4 HSPN Hsp89 Hsp90 LAP2
Gene ID:
Human(3320) Summary: The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(15519) heat shock protein 90, alpha (cytosolic), class A member 1
Rat(299331) heat shock protein 90, alpha (cytosolic), class A member 1
chicken(423463) heat shock protein 90kDa alpha (cytosolic), class A member 1
domestic cat(101094857) heat shock protein 90kDa alpha (cytosolic), class A member 1
cow(281832) heat shock protein 90kDa alpha (cytosolic), class A member 1
Horse(100033837) heat shock protein 90kDa alpha (cytosolic), class A member 1
dog(480438) heat shock protein 90kDa alpha (cytosolic), class A member 1
Goat(100860851) heat shock protein 90kDa alpha (cytosolic), class A member 1
sheep(100127209) heat shock protein 90kDa alpha (cytosolic), class A member 1
domestic guinea pig(100733372) heat shock protein 90kDa alpha (cytosolic), class A member 1
naked mole-rat(101725326) heat shock protein 90kDa alpha (cytosolic), class A member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501461 Anti-HSP90A, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2101092 Anti-HSP90AA1 (ab1) antibody produced in rabbit affinity isolated antibody pig, mouse, rabbit, human, rat, sheep, rabbit, bovine, canine
western blot pricing
SAB2101093 Anti-HSP90AA1 (ab2) antibody produced in rabbit affinity isolated antibody sheep, rabbit, bovine, rat, horse, human, rabbit, pig, mouse, canine, guinea pig
immunohistochemistry, western blot pricing
SAB2900334 Anti-HSP90AA1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, rat, Drosophila, monkey, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB2107614 Anti-HSP90AA1 antibody produced in rabbit affinity isolated antibody human, horse, rabbit, mouse, sheep, guinea pig
ELISA, western blot pricing
SAB2107615 Anti-HSP90AA1 antibody produced in rabbit affinity isolated antibody horse, rabbit, sheep, guinea pig, goat, human, mouse
ELISA, western blot pricing
GW21241 Anti-HSPN antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
H1775 Monoclonal Anti-Heat Shock Protein 90 antibody produced in mouse clone AC-16, ascites fluid rabbit, mouse, chicken, wheat germ, Sf9 cell line, human, rat, Achlya
microarray, western blot pricing
SAB1305541 MONOCLONAL ANTI-HSP90 antibody produced in mouse clone 803CT9.1.2, crude ascites, buffered aqueous solution human, mouse
western blot pricing
SAB5300449 Monoclonal Anti-HSP90AA1 antibody produced in mouse clone 5G5, purified immunoglobulin, buffered aqueous solution human, mouse, monkey
ELISA, flow cytometry, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0935 AQUA Peptide HLEINPDHSIIETL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010480 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010480 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010480 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005348 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017963 Rosetta Predictions human pricing
NM_005348 Rosetta Predictions human pricing
NM_175761 Rosetta Predictions rat pricing
NM_010480 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306824 predicted 2015
2 SASI_Hs02_00306825 predicted 2939
3 SASI_Hs01_00219732 predicted 2905
4 SASI_Hs02_00306826 predicted 1978
5 SASI_Hs01_00219734 predicted 3002
6 SASI_Hs02_00306827 predicted 2889
7 SASI_Hs02_00306828 predicted 2080
8 SASI_Hs02_00306829 predicted 1965
9 SASI_Hs01_00219733 predicted 680
10 SASI_Hs02_00306830 predicted 2259
11 SASI_Hs01_00219735 predicted 451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339429 predicted 1493
2 SASI_Hs02_00339430 predicted 2421
3 SASI_Hs01_00190084 predicted 2385
4 SASI_Hs02_00339431 predicted 1456
5 SASI_Hs01_00190085 predicted 2489
6 SASI_Hs02_00339432 predicted 2361
7 SASI_Hs02_00339433 predicted 1552
8 SASI_Hs02_00339434 predicted 1444
9 SASI_Hs02_00339435 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069009 predicted 2288
2 SASI_Rn01_00069010 predicted 503
3 SASI_Rn01_00069011 predicted 1425
4 SASI_Rn01_00069012 predicted 283
5 SASI_Rn02_00269516 predicted 486
6 SASI_Rn01_00069013 predicted 1245
7 SASI_Rn01_00069015 predicted 477
8 SASI_Rn01_00069016 predicted 2112
9 SASI_Rn01_00069017 predicted 1436
10 SASI_Rn02_00269517 predicted 1197
11 SASI_Rn01_00069014 predicted 2158
12 SASI_Rn01_00069018 predicted 2231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010480 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318709 predicted 234
2 SASI_Mm02_00318710 predicted 206
3 SASI_Mm02_00318711 predicted 205
4 SASI_Mm01_00083831 predicted 244
5 SASI_Mm02_00318712 predicted 496
6 SASI_Mm02_00318713 predicted 2045
7 SASI_Mm02_00318714 predicted 2333
8 SASI_Mm01_00083825 predicted 1390
9 SASI_Mm01_00083826 predicted 2150
10 SASI_Mm02_00318715 predicted 2323
11 SASI_Mm01_00083827 predicted 1283
12 SASI_Mm01_00083828 predicted 1511
13 SASI_Mm01_00083829 predicted 1333
14 SASI_Mm01_00083830 predicted 1334
15 SASI_Mm01_00083832 predicted 2204
16 SASI_Mm01_00083833 predicted 2200
17 SASI_Mm01_00083834 predicted 1497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010480
VALIDATED
HSP90AA1 MISSION shRNA Bacterial Glycerol Stock
heat shock protein 90kDa alpha (cytosolic), class A member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-589s21c1
Sequence:CCGGACTGTCATCACGAAGCATAACCTCGAGGTTATGCTTCGTGATGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-2221s21c1
Sequence:CCGGATCAAGCTTGGTCTAGGTATTCTCGAGAATACCTAGACCAAGCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-1282s21c1
Sequence:CCGGCCTGAGTATCTGAATTTCATTCTCGAGAATGAAATTCAGATACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-440s21c1
Sequence:CCGGCCAAGGCCGACTTGATCAATACTCGAGTATTGATCAAGTCGGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-2743s21c1
Sequence:CCGGCCCGAGAACAACCCTAAGTTTCTCGAGAAACTTAGGGTTGTTCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010480.2-2630s1c1
Sequence:CCGGCCCGAGAACAACCCTAAGTTTCTCGAGAAACTTAGGGTTGTTCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010480.2-2120s1c1
Sequence:CCGGCTAGGTATTGATGAGGATGATCTCGAGATCATCCTCATCAATACCTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010480.2-1169s1c1
Sequence:CCGGCCTGAGTATCTGAATTTCATTCTCGAGAATGAAATTCAGATACTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010480.2-1824s1c1
Sequence:CCGGGCTGTATTGTCACAAGCACATCTCGAGATGTGCTTGTGACAATACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010480.2-1952s1c1
Sequence:CCGGCACTCCATTATTGAAACCTTACTCGAGTAAGGTTTCAATAATGGAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010480
VALIDATED
HSP90AA1 MISSION shRNA shRNA Plasmid DNA
heat shock protein 90kDa alpha (cytosolic), class A member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-589s21c1
Sequence:CCGGACTGTCATCACGAAGCATAACCTCGAGGTTATGCTTCGTGATGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-2221s21c1
Sequence:CCGGATCAAGCTTGGTCTAGGTATTCTCGAGAATACCTAGACCAAGCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-1282s21c1
Sequence:CCGGCCTGAGTATCTGAATTTCATTCTCGAGAATGAAATTCAGATACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-440s21c1
Sequence:CCGGCCAAGGCCGACTTGATCAATACTCGAGTATTGATCAAGTCGGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-2743s21c1
Sequence:CCGGCCCGAGAACAACCCTAAGTTTCTCGAGAAACTTAGGGTTGTTCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010480.2-2630s1c1
Sequence:CCGGCCCGAGAACAACCCTAAGTTTCTCGAGAAACTTAGGGTTGTTCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010480.2-2120s1c1
Sequence:CCGGCTAGGTATTGATGAGGATGATCTCGAGATCATCCTCATCAATACCTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010480.2-1169s1c1
Sequence:CCGGCCTGAGTATCTGAATTTCATTCTCGAGAATGAAATTCAGATACTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010480.2-1824s1c1
Sequence:CCGGGCTGTATTGTCACAAGCACATCTCGAGATGTGCTTGTGACAATACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010480.2-1952s1c1
Sequence:CCGGCACTCCATTATTGAAACCTTACTCGAGTAAGGTTTCAATAATGGAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010480
VALIDATED
HSP90AA1 MISSION shRNA Lentiviral Transduction Particles
heat shock protein 90kDa alpha (cytosolic), class A member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-589s21c1
Sequence:CCGGACTGTCATCACGAAGCATAACCTCGAGGTTATGCTTCGTGATGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-2221s21c1
Sequence:CCGGATCAAGCTTGGTCTAGGTATTCTCGAGAATACCTAGACCAAGCTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-1282s21c1
Sequence:CCGGCCTGAGTATCTGAATTTCATTCTCGAGAATGAAATTCAGATACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-440s21c1
Sequence:CCGGCCAAGGCCGACTTGATCAATACTCGAGTATTGATCAAGTCGGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321083    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010480.5-2743s21c1
Sequence:CCGGCCCGAGAACAACCCTAAGTTTCTCGAGAAACTTAGGGTTGTTCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008490    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010480.2-2630s1c1
Sequence:CCGGCCCGAGAACAACCCTAAGTTTCTCGAGAAACTTAGGGTTGTTCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010480.2-2120s1c1
Sequence:CCGGCTAGGTATTGATGAGGATGATCTCGAGATCATCCTCATCAATACCTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010480.2-1169s1c1
Sequence:CCGGCCTGAGTATCTGAATTTCATTCTCGAGAATGAAATTCAGATACTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010480.2-1824s1c1
Sequence:CCGGGCTGTATTGTCACAAGCACATCTCGAGATGTGCTTGTGACAATACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010480.2-1952s1c1
Sequence:CCGGCACTCCATTATTGAAACCTTACTCGAGTAAGGTTTCAATAATGGAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005348
VALIDATED
HSP90AA1 MISSION shRNA Bacterial Glycerol Stock
heat shock protein 90kDa alpha (cytosolic), class A member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-2493s21c1
Sequence:CCGGTATGGCATGACAACTACTTTACTCGAGTAAAGTAGTTGTCATGCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-746s21c1
Sequence:CCGGGTTATCCTACACCTGAAAGAACTCGAGTTCTTTCAGGTGTAGGATAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-414s21c1
Sequence:CCGGAGCTGCATATTAACCTTATACCTCGAGGTATAAGGTTAATATGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-779s21c1
Sequence:CCGGTACTTGGAGGAACGAAGAATACTCGAGTATTCTTCGTTCCTCCAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005348.3-997s21c1
Sequence:CCGGGAAGGATGGTGACAAGAAGAACTCGAGTTCTTCTTGTCACCATCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005348.x-1242s1c1
Sequence:CCGGCCCTCTAAACATATCCCGTGACTCGAGTCACGGGATATGTTTAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005348.x-616s1c1
Sequence:CCGGGTTATCCTACACCTGAAAGAACTCGAGTTCTTTCAGGTGTAGGATAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005348.x-158s1c1
Sequence:CCGGTCATCAATACTTTCTACTCGACTCGAGTCGAGTAGAAAGTATTGATGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005348.x-867s1c1
Sequence:CCGGGAAGGATGGTGACAAGAAGAACTCGAGTTCTTCTTGTCACCATCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005348.x-1505s1c1
Sequence:CCGGCCAGAATGAAGGAGAACCAGACTCGAGTCTGGTTCTCCTTCATTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005348
VALIDATED
HSP90AA1 MISSION shRNA shRNA Plasmid DNA
heat shock protein 90kDa alpha (cytosolic), class A member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-2493s21c1
Sequence:CCGGTATGGCATGACAACTACTTTACTCGAGTAAAGTAGTTGTCATGCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-746s21c1
Sequence:CCGGGTTATCCTACACCTGAAAGAACTCGAGTTCTTTCAGGTGTAGGATAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-414s21c1
Sequence:CCGGAGCTGCATATTAACCTTATACCTCGAGGTATAAGGTTAATATGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-779s21c1
Sequence:CCGGTACTTGGAGGAACGAAGAATACTCGAGTATTCTTCGTTCCTCCAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005348.3-997s21c1
Sequence:CCGGGAAGGATGGTGACAAGAAGAACTCGAGTTCTTCTTGTCACCATCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005348.x-1242s1c1
Sequence:CCGGCCCTCTAAACATATCCCGTGACTCGAGTCACGGGATATGTTTAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005348.x-616s1c1
Sequence:CCGGGTTATCCTACACCTGAAAGAACTCGAGTTCTTTCAGGTGTAGGATAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005348.x-158s1c1
Sequence:CCGGTCATCAATACTTTCTACTCGACTCGAGTCGAGTAGAAAGTATTGATGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005348.x-867s1c1
Sequence:CCGGGAAGGATGGTGACAAGAAGAACTCGAGTTCTTCTTGTCACCATCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005348.x-1505s1c1
Sequence:CCGGCCAGAATGAAGGAGAACCAGACTCGAGTCTGGTTCTCCTTCATTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005348
VALIDATED
HSP90AA1 MISSION shRNA Lentiviral Transduction Particles
heat shock protein 90kDa alpha (cytosolic), class A member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315007    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-2493s21c1
Sequence:CCGGTATGGCATGACAACTACTTTACTCGAGTAAAGTAGTTGTCATGCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-746s21c1
Sequence:CCGGGTTATCCTACACCTGAAAGAACTCGAGTTCTTTCAGGTGTAGGATAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-414s21c1
Sequence:CCGGAGCTGCATATTAACCTTATACCTCGAGGTATAAGGTTAATATGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_005348.3-779s21c1
Sequence:CCGGTACTTGGAGGAACGAAGAATACTCGAGTATTCTTCGTTCCTCCAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005348.3-997s21c1
Sequence:CCGGGAAGGATGGTGACAAGAAGAACTCGAGTTCTTCTTGTCACCATCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005348.x-1242s1c1
Sequence:CCGGCCCTCTAAACATATCCCGTGACTCGAGTCACGGGATATGTTTAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005348.x-616s1c1
Sequence:CCGGGTTATCCTACACCTGAAAGAACTCGAGTTCTTTCAGGTGTAGGATAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005348.x-158s1c1
Sequence:CCGGTCATCAATACTTTCTACTCGACTCGAGTCGAGTAGAAAGTATTGATGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_005348.x-867s1c1
Sequence:CCGGGAAGGATGGTGACAAGAAGAACTCGAGTTCTTCTTGTCACCATCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005348.x-1505s1c1
Sequence:CCGGCCAGAATGAAGGAGAACCAGACTCGAGTCTGGTTCTCCTTCATTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)