EMAIL THIS PAGE TO A FRIEND

HSP90AB1

heat shock protein 90kDa alpha (cytosolic), class B member 1

81 Gene Product Result for
Synonyms: D6S182 HSP84 HSP90B HSPC2 HSPCB
UniProtKB ID: P08238, B2R5P0, Q5T9W7, Q9NQW0, Q9NTK6
Gene ID:
Human(3326) Summary: This gene encodes a member of the heat shock protein 90 family; these proteins are involved in signal transduction, protein folding and degradation and morphological evolution. This gene encodes the constitutive form of the cytosolic 90 kDa heat-shock protein and is thought to play a role in gastric apoptosis and inflammation. Alternative splicing results in multiple transcript variants. Pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Dec 2012]
Mouse(15516) heat shock protein 90 alpha (cytosolic), class B member 1
Rat(301252) heat shock protein 90 alpha (cytosolic), class B member 1
Zebrafish(30573) heat shock protein 90, alpha (cytosolic), class B member 1
cow(767874) heat shock protein 90kDa alpha (cytosolic), class B member 1
Horse(100034150) heat shock protein 90kDa alpha (cytosolic), class B member 1
domestic cat(101095825) heat shock protein 90kDa alpha (cytosolic), class B member 1
dog(474919) heat shock protein 90kDa alpha (cytosolic), class B member 1
chicken(396188) heat shock protein 90kDa alpha (cytosolic), class B member 1
domestic guinea pig(100729935) heat shock protein 90kDa alpha (cytosolic), class B member 1
naked mole-rat(101699803) heat shock protein 90kDa alpha (cytosolic), class B member 1
Goat(100861006) heat shock protein 90kDa alpha (cytosolic), class B member 1
sheep(101117797) heat shock protein 90kDa alpha (cytosolic), class B member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300541 Anti-HSP90AB1 (Ab-254) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2701832 Anti-hsp90ab1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701806 Anti-hsp90ab1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA072606 Anti-HSP90AB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry, western blot pricing
HPA074351 Anti-HSP90AB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry, western blot pricing
AV09016 Anti-HSP90AB1 antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, goat, human, dog, mouse
immunohistochemistry, western blot pricing
SAB2107344 Anti-HSP90AB1 antibody produced in rabbit affinity isolated antibody horse, rat, bovine, guinea pig, rabbit, dog, sheep, mouse, human
western blot pricing
HPA055729 Anti-HSP90AB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4501462 Anti-HSP90B antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501463 Anti-HSP90B antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
AV09018 Anti-HSPCB antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1305467 ANTI-HSPCB(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4300158 Anti-phospho-HSP90AB1 (pSer254) antibody produced in rabbit affinity isolated antibody mouse, human
western blot pricing
SAB4504306 Anti-phospho-HSP90B (pSer226) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, western blot pricing
SAB4503764 Anti-phospho-HSP90B (pSer254) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
H1775 Monoclonal Anti-Heat Shock Protein 90 antibody produced in mouse clone AC-16, ascites fluid rabbit, mouse, chicken, wheat germ, Sf9 cell line, human, rat, Achlya
microarray, western blot pricing
SAB5300085 Monoclonal Anti-HSP90AB1 antibody produced in mouse clone 5G4, ascites fluid human, monkey, rat, mouse
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300086 Monoclonal Anti-HSP90AB1 antibody produced in mouse clone 1D9, ascites fluid human, rat, mouse, monkey
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007355 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007355 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007355 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008302 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008302 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008302 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007355 Rosetta Predictions human pricing
NM_001004082 Rosetta Predictions rat pricing
NM_008302 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007355 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055902 predicted 1335
2 SASI_Hs01_00055900 predicted 2118
3 SASI_Hs02_00343453 predicted 2240
4 SASI_Hs01_00055901 predicted 495
5 SASI_Hs01_00055903 predicted 488
6 SASI_Hs01_00055904 predicted 518
7 SASI_Hs01_00055905 predicted 690
8 SASI_Hs01_00055906 predicted 693
9 SASI_Hs01_00055907 predicted 685
10 SASI_Hs01_00055908 predicted 151
11 SASI_Hs01_00055909 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198110 predicted 1198
2 SASI_Rn02_00198111 predicted 1237
3 SASI_Rn02_00198112 predicted 1146
4 SASI_Rn01_00098082 predicted 1901
5 SASI_Rn01_00098083 predicted 1777
6 SASI_Rn02_00198113 predicted 1717
7 SASI_Rn02_00198114 predicted 491
8 SASI_Rn02_00198115 predicted 1453
9 SASI_Rn02_00198116 predicted 1152
10 SASI_Rn01_00098086 predicted 2073
11 SASI_Rn01_00098078 predicted 2054
12 SASI_Rn01_00098079 predicted 1928
13 SASI_Rn01_00098080 predicted 1374
14 SASI_Rn01_00098081 predicted 1936
15 SASI_Rn01_00098084 predicted 1204
16 SASI_Rn01_00098085 predicted 1254
17 SASI_Rn01_00098087 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008302 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064548 predicted 1206
2 SASI_Mm02_00313593 predicted 1774
3 SASI_Mm01_00064541 predicted 1400
4 SASI_Mm01_00064542 predicted 1481
5 SASI_Mm02_00313594 predicted 1824
6 SASI_Mm01_00064544 predicted 1838
7 SASI_Mm01_00064546 predicted 1217
8 SASI_Mm01_00064547 predicted 516
9 SASI_Mm01_00064549 predicted 1622
10 SASI_Mm01_00064550 predicted 1192
11 SASI_Mm01_00064543 predicted 1481
12 SASI_Mm01_00064545 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007355
VALIDATED
HSP90AB1 MISSION shRNA Bacterial Glycerol Stock
heat shock protein 90kDa alpha (cytosolic), class B member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007355.2-2402s1c1
Sequence:CCGGGCAGTAAACTAAGGGTGTCAACTCGAGTTGACACCCTTAGTTTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_007355.2-232s1c1
Sequence:CCGGGCCTTGGACAAGATTCGCTATCTCGAGATAGCGAATCTTGTCCAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007355.2-1362s1c1
Sequence:CCGGCAAGAAATTCTATGAGGCATTCTCGAGAATGCCTCATAGAATTTCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007355.2-150s1c1
Sequence:CCGGCCAACTCATGTCCCTCATCATCTCGAGATGATGAGGGACATGAGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007355.2-2128s1c1
Sequence:CCGGCGCATGATCAAGCTAGGTCTACTCGAGTAGACCTAGCTTGATCATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007355.2-2010s21c1
Sequence:CCGGTGAGGCCGACAAGAATGATAACTCGAGTTATCATTCTTGTCGGCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007355.2-1922s21c1
Sequence:CCGGACAACTCCACCATGGGCTATACTCGAGTATAGCCCATGGTGGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007355.2-2390s21c1
Sequence:CCGGCTTGTGTTGAAGGCAGTAAACCTCGAGGTTTACTGCCTTCAACACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007355.2-2239s21c1
Sequence:CCGGCGCATGGAAGAAGTCGATTAGCTCGAGCTAATCGACTTCTTCCATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007355.2-530s21c1
Sequence:CCGGACAACGATGATGAACAGTATGCTCGAGCATACTGTTCATCATCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007355
VALIDATED
HSP90AB1 MISSION shRNA shRNA Plasmid DNA
heat shock protein 90kDa alpha (cytosolic), class B member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007355.2-2402s1c1
Sequence:CCGGGCAGTAAACTAAGGGTGTCAACTCGAGTTGACACCCTTAGTTTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_007355.2-232s1c1
Sequence:CCGGGCCTTGGACAAGATTCGCTATCTCGAGATAGCGAATCTTGTCCAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007355.2-1362s1c1
Sequence:CCGGCAAGAAATTCTATGAGGCATTCTCGAGAATGCCTCATAGAATTTCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007355.2-150s1c1
Sequence:CCGGCCAACTCATGTCCCTCATCATCTCGAGATGATGAGGGACATGAGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007355.2-2128s1c1
Sequence:CCGGCGCATGATCAAGCTAGGTCTACTCGAGTAGACCTAGCTTGATCATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007355.2-2010s21c1
Sequence:CCGGTGAGGCCGACAAGAATGATAACTCGAGTTATCATTCTTGTCGGCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007355.2-1922s21c1
Sequence:CCGGACAACTCCACCATGGGCTATACTCGAGTATAGCCCATGGTGGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007355.2-2390s21c1
Sequence:CCGGCTTGTGTTGAAGGCAGTAAACCTCGAGGTTTACTGCCTTCAACACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007355.2-2239s21c1
Sequence:CCGGCGCATGGAAGAAGTCGATTAGCTCGAGCTAATCGACTTCTTCCATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007355.2-530s21c1
Sequence:CCGGACAACGATGATGAACAGTATGCTCGAGCATACTGTTCATCATCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007355
VALIDATED
HSP90AB1 MISSION shRNA Lentiviral Transduction Particles
heat shock protein 90kDa alpha (cytosolic), class B member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007355.2-2402s1c1
Sequence:CCGGGCAGTAAACTAAGGGTGTCAACTCGAGTTGACACCCTTAGTTTACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_007355.2-232s1c1
Sequence:CCGGGCCTTGGACAAGATTCGCTATCTCGAGATAGCGAATCTTGTCCAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007355.2-1362s1c1
Sequence:CCGGCAAGAAATTCTATGAGGCATTCTCGAGAATGCCTCATAGAATTTCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007355.2-150s1c1
Sequence:CCGGCCAACTCATGTCCCTCATCATCTCGAGATGATGAGGGACATGAGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007355.2-2128s1c1
Sequence:CCGGCGCATGATCAAGCTAGGTCTACTCGAGTAGACCTAGCTTGATCATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007355.2-2010s21c1
Sequence:CCGGTGAGGCCGACAAGAATGATAACTCGAGTTATCATTCTTGTCGGCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007355.2-1922s21c1
Sequence:CCGGACAACTCCACCATGGGCTATACTCGAGTATAGCCCATGGTGGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315416    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_007355.2-2390s21c1
Sequence:CCGGCTTGTGTTGAAGGCAGTAAACCTCGAGGTTTACTGCCTTCAACACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007355.2-2239s21c1
Sequence:CCGGCGCATGGAAGAAGTCGATTAGCTCGAGCTAATCGACTTCTTCCATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007355.2-530s21c1
Sequence:CCGGACAACGATGATGAACAGTATGCTCGAGCATACTGTTCATCATCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008302
VALIDATED
HSP90AB1 MISSION shRNA Bacterial Glycerol Stock
heat shock protein 90kDa alpha (cytosolic), class B member 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008302.2-2348s1c1
Sequence:CCGGGCTCATGTCTACAAGAATCTTCTCGAGAAGATTCTTGTAGACATGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-938s1c1
Sequence:CCGGGCTGAACAAGACAAAGCCTATCTCGAGATAGGCTTTGTCTTGTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-243s1c1
Sequence:CCGGGCCCTGGACAAGATTCGATATCTCGAGATATCGAATCTTGTCCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-1307s1c1
Sequence:CCGGCCGCAAGAACATCGTCAAGAACTCGAGTTCTTGACGATGTTCTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-986s1c1
Sequence:CCGGGCAGGAGGAGTATGGCGAATTCTCGAGAATTCGCCATACTCCTCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008302.3-2252s21c1
Sequence:CCGGCATGGAAGAGGTGGATTAAAGCTCGAGCTTTAATCCACCTCTTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008302.3-2348s21c1
Sequence:CCGGGCTCATGTCTACAAGAATCTTCTCGAGAAGATTCTTGTAGACATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008302.3-986s21c1
Sequence:CCGGGCAGGAGGAGTATGGCGAATTCTCGAGAATTCGCCATACTCCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008302.3-1307s21c1
Sequence:CCGGCCGCAAGAACATCGTCAAGAACTCGAGTTCTTGACGATGTTCTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008302
VALIDATED
HSP90AB1 MISSION shRNA shRNA Plasmid DNA
heat shock protein 90kDa alpha (cytosolic), class B member 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008302.2-2348s1c1
Sequence:CCGGGCTCATGTCTACAAGAATCTTCTCGAGAAGATTCTTGTAGACATGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-938s1c1
Sequence:CCGGGCTGAACAAGACAAAGCCTATCTCGAGATAGGCTTTGTCTTGTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-243s1c1
Sequence:CCGGGCCCTGGACAAGATTCGATATCTCGAGATATCGAATCTTGTCCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-1307s1c1
Sequence:CCGGCCGCAAGAACATCGTCAAGAACTCGAGTTCTTGACGATGTTCTTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-986s1c1
Sequence:CCGGGCAGGAGGAGTATGGCGAATTCTCGAGAATTCGCCATACTCCTCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008302.3-2252s21c1
Sequence:CCGGCATGGAAGAGGTGGATTAAAGCTCGAGCTTTAATCCACCTCTTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008302.3-2348s21c1
Sequence:CCGGGCTCATGTCTACAAGAATCTTCTCGAGAAGATTCTTGTAGACATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008302.3-986s21c1
Sequence:CCGGGCAGGAGGAGTATGGCGAATTCTCGAGAATTCGCCATACTCCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008302.3-1307s21c1
Sequence:CCGGCCGCAAGAACATCGTCAAGAACTCGAGTTCTTGACGATGTTCTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008302
VALIDATED
HSP90AB1 MISSION shRNA Lentiviral Transduction Particles
heat shock protein 90kDa alpha (cytosolic), class B member 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008495    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008302.2-2348s1c1
Sequence:CCGGGCTCATGTCTACAAGAATCTTCTCGAGAAGATTCTTGTAGACATGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-938s1c1
Sequence:CCGGGCTGAACAAGACAAAGCCTATCTCGAGATAGGCTTTGTCTTGTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-243s1c1
Sequence:CCGGGCCCTGGACAAGATTCGATATCTCGAGATATCGAATCTTGTCCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-1307s1c1
Sequence:CCGGCCGCAAGAACATCGTCAAGAACTCGAGTTCTTGACGATGTTCTTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008302.2-986s1c1
Sequence:CCGGGCAGGAGGAGTATGGCGAATTCTCGAGAATTCGCCATACTCCTCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008302.3-2252s21c1
Sequence:CCGGCATGGAAGAGGTGGATTAAAGCTCGAGCTTTAATCCACCTCTTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008302.3-2348s21c1
Sequence:CCGGGCTCATGTCTACAAGAATCTTCTCGAGAAGATTCTTGTAGACATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008302.3-986s21c1
Sequence:CCGGGCAGGAGGAGTATGGCGAATTCTCGAGAATTCGCCATACTCCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008302.3-1307s21c1
Sequence:CCGGCCGCAAGAACATCGTCAAGAACTCGAGTTCTTGACGATGTTCTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)