EMAIL THIS PAGE TO A FRIEND

HSP90AB2P

heat shock protein 90kDa alpha (cytosolic), class B member 2, pseudogene

24 Gene Product Result for
Synonyms: HSP90BB
Species: Human HSP90AB2P(391634)
UniProtKB ID: Q58FF8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001014368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001014368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001014368 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014368 Rosetta Predictions human pricing
NR_003132 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163315 predicted 1001
2 SASI_Hs01_00163316 predicted 293
3 SASI_Hs01_00163317 predicted 298
4 SASI_Hs01_00163318 predicted 1010
5 SASI_Hs01_00163319 predicted 297
6 SASI_Hs01_00163320 predicted 289
7 SASI_Hs01_00163321 predicted 1009
8 SASI_Hs01_00163322 predicted 292
9 SASI_Hs01_00163323 predicted 972
10 SASI_Hs01_00163324 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378362 predicted 3383
2 SASI_Hs02_00378363 predicted 3134
3 SASI_Hs02_00378364 predicted 4448
4 SASI_Hs02_00378365 predicted 3138
5 SASI_Hs02_00378366 predicted 3231
6 SASI_Hs02_00378367 predicted 4114
7 SASI_Hs02_00378368 predicted 4378
8 SASI_Hs02_00378369 predicted 3131
9 SASI_Hs02_00378370 predicted 3038
10 SASI_Hs02_00378371 predicted 3507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014368
HSP90AB2P MISSION shRNA Bacterial Glycerol Stock
heat shock protein 90kDa alpha (cytosolic), class B member 2, pseudogene
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-632s1c1
Sequence:CCGGCCAAGATCGAAGATGTGGGTTCTCGAGAACCCACATCTTCGATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-1084s1c1
Sequence:CCGGGAGGAGAAGAAGAGAATGGAACTCGAGTTCCATTCTCTTCTTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-1107s1c1
Sequence:CCGGGAGGAAGGCAAAGTTTGAGAACTCGAGTTCTCAAACTTTGCCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-189s1c1
Sequence:CCGGCCAACTCATGTCTCTTATCATCTCGAGATGATAAGAGACATGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-404s1c1
Sequence:CCGGCCAAAGCTGATCTCATAAATACTCGAGTATTTATGAGATCAGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-550s1c1
Sequence:CCGGCGAGAGAAAGAAATTAGTGATCTCGAGATCACTAATTTCTTTCTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-52s1c1
Sequence:CCGGGAGTGCTATTGCAAACAACATCTCGAGATGTTGTTTGCAATAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-885s1c1
Sequence:CCGGGATACAGAAGTCCATCTATTACTCGAGTAATAGATGGACTTCTGTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-444s1c1
Sequence:CCGGGTTTCAAGATCAGACAGAGTACTCGAGTACTCTGTCTGATCTTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-583s1c1
Sequence:CCGGGAAGAGAAAGGTGAGAAAGAACTCGAGTTCTTTCTCACCTTTCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-472s1c1
Sequence:CCGGGAGATGCAGGTCAAAGAAGTACTCGAGTACTTCTTTGACCTGCATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-879s1c1
Sequence:CCGGGAAGGAGATACAGAAGTCCATCTCGAGATGGACTTCTGTATCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014368
HSP90AB2P MISSION shRNA shRNA Plasmid DNA
heat shock protein 90kDa alpha (cytosolic), class B member 2, pseudogene
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-632s1c1
Sequence:CCGGCCAAGATCGAAGATGTGGGTTCTCGAGAACCCACATCTTCGATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-1084s1c1
Sequence:CCGGGAGGAGAAGAAGAGAATGGAACTCGAGTTCCATTCTCTTCTTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-1107s1c1
Sequence:CCGGGAGGAAGGCAAAGTTTGAGAACTCGAGTTCTCAAACTTTGCCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-189s1c1
Sequence:CCGGCCAACTCATGTCTCTTATCATCTCGAGATGATAAGAGACATGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-404s1c1
Sequence:CCGGCCAAAGCTGATCTCATAAATACTCGAGTATTTATGAGATCAGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-550s1c1
Sequence:CCGGCGAGAGAAAGAAATTAGTGATCTCGAGATCACTAATTTCTTTCTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-52s1c1
Sequence:CCGGGAGTGCTATTGCAAACAACATCTCGAGATGTTGTTTGCAATAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-885s1c1
Sequence:CCGGGATACAGAAGTCCATCTATTACTCGAGTAATAGATGGACTTCTGTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-444s1c1
Sequence:CCGGGTTTCAAGATCAGACAGAGTACTCGAGTACTCTGTCTGATCTTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-583s1c1
Sequence:CCGGGAAGAGAAAGGTGAGAAAGAACTCGAGTTCTTTCTCACCTTTCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-472s1c1
Sequence:CCGGGAGATGCAGGTCAAAGAAGTACTCGAGTACTTCTTTGACCTGCATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-879s1c1
Sequence:CCGGGAAGGAGATACAGAAGTCCATCTCGAGATGGACTTCTGTATCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014368
HSP90AB2P MISSION shRNA Lentiviral Transduction Particles
heat shock protein 90kDa alpha (cytosolic), class B member 2, pseudogene
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-632s1c1
Sequence:CCGGCCAAGATCGAAGATGTGGGTTCTCGAGAACCCACATCTTCGATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-1084s1c1
Sequence:CCGGGAGGAGAAGAAGAGAATGGAACTCGAGTTCCATTCTCTTCTTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161625    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-1107s1c1
Sequence:CCGGGAGGAAGGCAAAGTTTGAGAACTCGAGTTCTCAAACTTTGCCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-189s1c1
Sequence:CCGGCCAACTCATGTCTCTTATCATCTCGAGATGATAAGAGACATGAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-404s1c1
Sequence:CCGGCCAAAGCTGATCTCATAAATACTCGAGTATTTATGAGATCAGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-550s1c1
Sequence:CCGGCGAGAGAAAGAAATTAGTGATCTCGAGATCACTAATTTCTTTCTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-52s1c1
Sequence:CCGGGAGTGCTATTGCAAACAACATCTCGAGATGTTGTTTGCAATAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-885s1c1
Sequence:CCGGGATACAGAAGTCCATCTATTACTCGAGTAATAGATGGACTTCTGTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-444s1c1
Sequence:CCGGGTTTCAAGATCAGACAGAGTACTCGAGTACTCTGTCTGATCTTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014368.1-583s1c1
Sequence:CCGGGAAGAGAAAGGTGAGAAAGAACTCGAGTTCTTTCTCACCTTTCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161095    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-472s1c1
Sequence:CCGGGAGATGCAGGTCAAAGAAGTACTCGAGTACTTCTTTGACCTGCATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001014368.1-879s1c1
Sequence:CCGGGAAGGAGATACAGAAGTCCATCTCGAGATGGACTTCTGTATCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)