EMAIL THIS PAGE TO A FRIEND

HSP90AB6P

heat shock protein 90kDa alpha (cytosolic), class B member 6, pseudogene

Gene Product Result for
Synonyms: HSP90Bf
Species: Human HSP90AB6P(541611)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001014441
HSP90AB6P MISSION shRNA Bacterial Glycerol Stock
heat shock protein 90kDa alpha (cytosolic), class B member 6, pseudogene
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000147710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014441.1-914s1c1
Sequence:CCGGGACAACTCTATGATGGGTTATCTCGAGATAACCCATCATAGAGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014441.1-390s1c1
Sequence:CCGGCAAGACCATTTGGACAAGAAACTCGAGTTTCTTGTCCAAATGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001014441
HSP90AB6P MISSION shRNA shRNA Plasmid DNA
heat shock protein 90kDa alpha (cytosolic), class B member 6, pseudogene
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000147710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014441.1-914s1c1
Sequence:CCGGGACAACTCTATGATGGGTTATCTCGAGATAACCCATCATAGAGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014441.1-390s1c1
Sequence:CCGGCAAGACCATTTGGACAAGAAACTCGAGTTTCTTGTCCAAATGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001014441
HSP90AB6P MISSION shRNA Lentiviral Transduction Particles
heat shock protein 90kDa alpha (cytosolic), class B member 6, pseudogene
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000147710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014441.1-914s1c1
Sequence:CCGGGACAACTCTATGATGGGTTATCTCGAGATAACCCATCATAGAGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001014441.1-390s1c1
Sequence:CCGGCAAGACCATTTGGACAAGAAACTCGAGTTTCTTGTCCAAATGGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)