EMAIL THIS PAGE TO A FRIEND

HSP90B1

heat shock protein 90kDa beta (Grp94), member 1

106 Gene Product Result for
Synonyms: ECGP GP96 GRP94 TRA1
UniProtKB ID: P14625, Q96A97
Gene ID:
Human(7184) Summary: This gene encodes a member of a family of adenosine triphosphate(ATP)-metabolizing molecular chaperones with roles in stabilizing and folding other proteins. The encoded protein is localized to melanosomes and the endoplasmic reticulum. Expression of this protein is associated with a variety of pathogenic states, including tumor formation. There is a microRNA gene located within the 5' exon of this gene. There are pseudogenes for this gene on chromosomes 1 and 15. [provided by RefSeq, Aug 2012]
Mouse(22027) heat shock protein 90, beta (Grp94), member 1
Rat(362862) heat shock protein 90, beta, member 1
Zebrafish(386590) heat shock protein 90, beta (grp94), member 1
dog(404019) heat shock protein 90kDa beta (Grp94), member 1
domestic cat(101082249) heat shock protein 90kDa beta (Grp94), member 1
cow(282646) heat shock protein 90kDa beta (Grp94), member 1
chicken(374163) heat shock protein 90kDa beta (Grp94), member 1
sheep(101111703) heat shock protein 90kDa beta (Grp94), member 1
domestic guinea pig(100723767) heat shock protein 90kDa beta (Grp94), member 1
naked mole-rat(101704175) heat shock protein 90kDa beta (Grp94), member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2500482 Anti-GPR94/TRA1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunohistochemistry, western blot pricing
G4420 Anti-GRP94 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution canine, mouse, human
immunocytochemistry, immunofluorescence, immunoprecipitation (IP), microarray, western blot pricing
SAB4503031 Anti-GRP94, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA003901 Anti-HSP90B1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA008424 Anti-HSP90B1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AV40464 Anti-HSP90B1 antibody produced in rabbit IgG fraction of antiserum bovine, mouse, horse, rat, human, rabbit, dog, guinea pig
immunohistochemistry, western blot pricing
SAB2101094 Anti-HSP90B1 antibody produced in rabbit affinity isolated antibody human, yeast
immunohistochemistry, western blot pricing
AMAB91019 Monoclonal Anti-HSP90B1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2647, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1402948 Monoclonal Anti-TRA1 antibody produced in mouse clone 1A8, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003299 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003299 Rosetta Predictions human pricing
NM_001012197 Rosetta Predictions rat pricing
XM_576206 Rosetta Predictions rat pricing
NM_011631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237600 predicted 1287
2 SASI_Hs01_00237608 predicted 1755
3 SASI_Hs02_00335391 predicted 654
4 SASI_Hs01_00237599 predicted 404
5 SASI_Hs01_00237606 predicted 600
6 SASI_Hs01_00237607 predicted 683
7 SASI_Hs02_00335392 predicted 276
8 SASI_Hs02_00335393 predicted 2116
9 SASI_Hs02_00335394 predicted 685
10 SASI_Hs02_00335395 predicted 162
11 SASI_Hs01_00237601 predicted 663
12 SASI_Hs01_00237602 predicted 1333
13 SASI_Hs01_00237603 predicted 1320
14 SASI_Hs01_00237604 predicted 1538
15 SASI_Hs01_00237605 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012197 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200415 predicted 1805
2 SASI_Rn01_00085047 predicted 429
3 SASI_Rn01_00085048 predicted 1669
4 SASI_Rn01_00085049 predicted 1497
5 SASI_Rn01_00085050 predicted 1587
6 SASI_Rn01_00085051 predicted 784
7 SASI_Rn01_00085052 predicted 1336
8 SASI_Rn01_00085053 predicted 1326
9 SASI_Rn02_00200416 predicted 667
10 SASI_Rn01_00085055 predicted 2049
11 SASI_Rn01_00085046 predicted 1450
12 SASI_Rn01_00085054 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576206 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00186723 predicted 1504
2 SASI_Rn01_00186724 predicted 485
3 SASI_Rn01_00186725 predicted 1722
4 SASI_Rn01_00186726 predicted 1558
5 SASI_Rn01_00186727 predicted 1651
6 SASI_Rn01_00186728 predicted 834
7 SASI_Rn01_00186729 predicted 1399
8 SASI_Rn01_00186730 predicted 1384
9 SASI_Rn01_00186731 predicted 1137
10 SASI_Rn01_00186732 predicted 979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321078 predicted 1418
2 SASI_Mm01_00089574 predicted 394
3 SASI_Mm01_00089575 predicted 1291
4 SASI_Mm01_00089576 predicted 2216
5 SASI_Mm01_00089577 predicted 251
6 SASI_Mm01_00089578 predicted 1629
7 SASI_Mm01_00089580 predicted 2286
8 SASI_Mm01_00089581 predicted 2172
9 SASI_Mm01_00089582 predicted 2104
10 SASI_Mm01_00089583 predicted 464
11 SASI_Mm01_00089579 predicted 1317
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011631
VALIDATED
HSP90B1 MISSION shRNA Bacterial Glycerol Stock
heat shock protein 90kDa beta (Grp94), member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-1575s21c1
Sequence:CCGGGTGATTGAAGACCACTCAAATCTCGAGATTTGAGTGGTCTTCAATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-252s21c1
Sequence:CCGGGCTATTCAGTTGGATGGGTTACTCGAGTAACCCATCCAACTGAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-1965s21c1
Sequence:CCGGGCCCTCAAGGACAAGATAGAACTCGAGTTCTATCTTGTCCTTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011631.1-1965s1c1
Sequence:CCGGGCCCTCAAGGACAAGATAGAACTCGAGTTCTATCTTGTCCTTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-583s1c1
Sequence:CCGGCCATAGCCAAATCTGGAACAACTCGAGTTGTTCCAGATTTGGCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-2184s1c1
Sequence:CCGGCGGCGGATTAAGGAAGATGAACTCGAGTTCATCTTCCTTAATCCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-1355s1c1
Sequence:CCGGCCATGATATGATGCCCAAATACTCGAGTATTTGGGCATCATATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-252s1c1
Sequence:CCGGGCTATTCAGTTGGATGGGTTACTCGAGTAACCCATCCAACTGAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011631.1-2499s21c1
Sequence:CCGGATTATACTCTCGCTATGAATCCTCGAGGATTCATAGCGAGAGTATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-1355s21c1
Sequence:CCGGCCATGATATGATGCCCAAATACTCGAGTATTTGGGCATCATATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011631
VALIDATED
HSP90B1 MISSION shRNA shRNA Plasmid DNA
heat shock protein 90kDa beta (Grp94), member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-1575s21c1
Sequence:CCGGGTGATTGAAGACCACTCAAATCTCGAGATTTGAGTGGTCTTCAATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-252s21c1
Sequence:CCGGGCTATTCAGTTGGATGGGTTACTCGAGTAACCCATCCAACTGAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-1965s21c1
Sequence:CCGGGCCCTCAAGGACAAGATAGAACTCGAGTTCTATCTTGTCCTTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011631.1-1965s1c1
Sequence:CCGGGCCCTCAAGGACAAGATAGAACTCGAGTTCTATCTTGTCCTTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-583s1c1
Sequence:CCGGCCATAGCCAAATCTGGAACAACTCGAGTTGTTCCAGATTTGGCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-2184s1c1
Sequence:CCGGCGGCGGATTAAGGAAGATGAACTCGAGTTCATCTTCCTTAATCCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-1355s1c1
Sequence:CCGGCCATGATATGATGCCCAAATACTCGAGTATTTGGGCATCATATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-252s1c1
Sequence:CCGGGCTATTCAGTTGGATGGGTTACTCGAGTAACCCATCCAACTGAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011631.1-2499s21c1
Sequence:CCGGATTATACTCTCGCTATGAATCCTCGAGGATTCATAGCGAGAGTATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-1355s21c1
Sequence:CCGGCCATGATATGATGCCCAAATACTCGAGTATTTGGGCATCATATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011631
VALIDATED
HSP90B1 MISSION shRNA Lentiviral Transduction Particles
heat shock protein 90kDa beta (Grp94), member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-1575s21c1
Sequence:CCGGGTGATTGAAGACCACTCAAATCTCGAGATTTGAGTGGTCTTCAATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-252s21c1
Sequence:CCGGGCTATTCAGTTGGATGGGTTACTCGAGTAACCCATCCAACTGAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-1965s21c1
Sequence:CCGGGCCCTCAAGGACAAGATAGAACTCGAGTTCTATCTTGTCCTTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011631.1-1965s1c1
Sequence:CCGGGCCCTCAAGGACAAGATAGAACTCGAGTTCTATCTTGTCCTTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-583s1c1
Sequence:CCGGCCATAGCCAAATCTGGAACAACTCGAGTTGTTCCAGATTTGGCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-2184s1c1
Sequence:CCGGCGGCGGATTAAGGAAGATGAACTCGAGTTCATCTTCCTTAATCCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-1355s1c1
Sequence:CCGGCCATGATATGATGCCCAAATACTCGAGTATTTGGGCATCATATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011631.1-252s1c1
Sequence:CCGGGCTATTCAGTTGGATGGGTTACTCGAGTAACCCATCCAACTGAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011631.1-2499s21c1
Sequence:CCGGATTATACTCTCGCTATGAATCCTCGAGGATTCATAGCGAGAGTATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011631.1-1355s21c1
Sequence:CCGGCCATGATATGATGCCCAAATACTCGAGTATTTGGGCATCATATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003299
VALIDATED
HSP90B1 MISSION shRNA Bacterial Glycerol Stock
heat shock protein 90kDa beta (Grp94), member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1371s21c1
Sequence:CCGGCCATGATATGATGCCTAAATACTCGAGTATTTAGGCATCATATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1448s21c1
Sequence:CCGGGCGAGACTCTTCAGCAACATACTCGAGTATGTTGCTGAAGAGTCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1288s21c1
Sequence:CCGGCGTGGTCTGTTTGACGAATATCTCGAGATATTCGTCAAACAGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-2538s21c1
Sequence:CCGGATCCTGTGTGGAGAGGGAATGCTCGAGCATTCCCTCTCCACACAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003299.1-1448s1c1
Sequence:CCGGGCGAGACTCTTCAGCAACATACTCGAGTATGTTGCTGAAGAGTCTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003299.1-436s1c1
Sequence:CCGGGCTTTAGATAAGATAAGGCTACTCGAGTAGCCTTATCTTATCTAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003299.1-2200s1c1
Sequence:CCGGCGACGAATTAAGGAAGATGAACTCGAGTTCATCTTCCTTAATTCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003299.1-1288s1c1
Sequence:CCGGCGTGGTCTGTTTGACGAATATCTCGAGATATTCGTCAAACAGACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003299.1-1816s1c1
Sequence:CCGGCCTGTGGATGAATACTGTATTCTCGAGAATACAGTATTCATCCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1816s21c1
Sequence:CCGGCCTGTGGATGAATACTGTATTCTCGAGAATACAGTATTCATCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003299
VALIDATED
HSP90B1 MISSION shRNA shRNA Plasmid DNA
heat shock protein 90kDa beta (Grp94), member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1371s21c1
Sequence:CCGGCCATGATATGATGCCTAAATACTCGAGTATTTAGGCATCATATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1448s21c1
Sequence:CCGGGCGAGACTCTTCAGCAACATACTCGAGTATGTTGCTGAAGAGTCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1288s21c1
Sequence:CCGGCGTGGTCTGTTTGACGAATATCTCGAGATATTCGTCAAACAGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-2538s21c1
Sequence:CCGGATCCTGTGTGGAGAGGGAATGCTCGAGCATTCCCTCTCCACACAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003299.1-1448s1c1
Sequence:CCGGGCGAGACTCTTCAGCAACATACTCGAGTATGTTGCTGAAGAGTCTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003299.1-436s1c1
Sequence:CCGGGCTTTAGATAAGATAAGGCTACTCGAGTAGCCTTATCTTATCTAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003299.1-2200s1c1
Sequence:CCGGCGACGAATTAAGGAAGATGAACTCGAGTTCATCTTCCTTAATTCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003299.1-1288s1c1
Sequence:CCGGCGTGGTCTGTTTGACGAATATCTCGAGATATTCGTCAAACAGACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003299.1-1816s1c1
Sequence:CCGGCCTGTGGATGAATACTGTATTCTCGAGAATACAGTATTCATCCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1816s21c1
Sequence:CCGGCCTGTGGATGAATACTGTATTCTCGAGAATACAGTATTCATCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003299
VALIDATED
HSP90B1 MISSION shRNA Lentiviral Transduction Particles
heat shock protein 90kDa beta (Grp94), member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1371s21c1
Sequence:CCGGCCATGATATGATGCCTAAATACTCGAGTATTTAGGCATCATATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1448s21c1
Sequence:CCGGGCGAGACTCTTCAGCAACATACTCGAGTATGTTGCTGAAGAGTCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1288s21c1
Sequence:CCGGCGTGGTCTGTTTGACGAATATCTCGAGATATTCGTCAAACAGACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-2538s21c1
Sequence:CCGGATCCTGTGTGGAGAGGGAATGCTCGAGCATTCCCTCTCCACACAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003299.1-1448s1c1
Sequence:CCGGGCGAGACTCTTCAGCAACATACTCGAGTATGTTGCTGAAGAGTCTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003299.1-436s1c1
Sequence:CCGGGCTTTAGATAAGATAAGGCTACTCGAGTAGCCTTATCTTATCTAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003299.1-2200s1c1
Sequence:CCGGCGACGAATTAAGGAAGATGAACTCGAGTTCATCTTCCTTAATTCGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003299.1-1288s1c1
Sequence:CCGGCGTGGTCTGTTTGACGAATATCTCGAGATATTCGTCAAACAGACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003299.1-1816s1c1
Sequence:CCGGCCTGTGGATGAATACTGTATTCTCGAGAATACAGTATTCATCCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003299.1-1816s21c1
Sequence:CCGGCCTGTGGATGAATACTGTATTCTCGAGAATACAGTATTCATCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)