EMAIL THIS PAGE TO A FRIEND

HSPA12A

heat shock 70kDa protein 12A

200 Gene Product Result for
UniProtKB ID: O43301
Gene ID:
Mouse(73442) heat shock protein 12A
Rat(307997) heat shock protein 12A
Goat(100861045) heat shock 70kDa protein 12A
sheep(101120879) heat shock 70kDa protein 12A
domestic guinea pig(100721118) heat shock 70kDa protein 12A
naked mole-rat(101726693) heat shock 70kDa protein 12A
Zebrafish(751725) heat shock protein 12A
dog(486904) heat shock 70kDa protein 12A
Horse(100067692) heat shock 70kDa protein 12A
cow(540050) heat shock 70kDa protein 12A
domestic cat(101084233) heat shock 70kDa protein 12A
chicken(423917) heat shock 70kDa protein 12A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175199 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175199 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175199 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025015 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006321 MISSION® esiRNA esiRNA targeting human HSPA12A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025015 Rosetta Predictions human pricing
XM_048898 Rosetta Predictions human pricing
NM_001107445 Rosetta Predictions rat pricing
NM_175199 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357675 predicted 1290
2 SASI_Hs02_00357676 predicted 1321
3 SASI_Hs02_00357677 predicted 2054
4 SASI_Hs02_00357678 predicted 1143
5 SASI_Hs02_00357679 predicted 2164
6 SASI_Hs02_00357680 predicted 583
7 SASI_Hs02_00357681 predicted 597
8 SASI_Hs02_00357682 predicted 920
9 SASI_Hs02_00357683 predicted 2075
10 SASI_Hs02_00357684 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_048898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266565 predicted 1929
2 SASI_Hs01_00266566 predicted 2697
3 SASI_Hs01_00266567 predicted 1778
4 SASI_Hs01_00266568 predicted 2809
5 SASI_Hs01_00266569 predicted 1225
6 SASI_Hs01_00266570 predicted 1236
7 SASI_Hs01_00266571 predicted 1571
8 SASI_Hs01_00266572 predicted 2716
9 SASI_Hs01_00266573 predicted 1787
10 SASI_Hs01_00266574 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107445 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228895 predicted 2673
2 SASI_Rn02_00228896 predicted 1745
3 SASI_Rn02_00228897 predicted 2712
4 SASI_Rn02_00228898 predicted 1101
5 SASI_Rn02_00228899 predicted 1285
6 SASI_Rn02_00228900 predicted 708
7 SASI_Rn02_00228901 predicted 923
8 SASI_Rn02_00228902 predicted 1243
9 SASI_Rn02_00228903 predicted 2044
10 SASI_Rn02_00228904 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133161 predicted 1310
2 SASI_Mm01_00133162 predicted 1360
3 SASI_Mm01_00133163 predicted 2219
4 SASI_Mm01_00133164 predicted 311
5 SASI_Mm01_00133165 predicted 1052
6 SASI_Mm01_00133166 predicted 567
7 SASI_Mm01_00133167 predicted 1425
8 SASI_Mm01_00133168 predicted 567
9 SASI_Mm02_00345863 predicted 629
10 SASI_Mm02_00345864 predicted 399
11 SASI_Mm01_00133160 predicted 1212
12 SASI_Mm01_00133169 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175199
HSPA12A MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 12A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-1198s21c1
Sequence:CCGGTCGAACAGTTCAAGATCAAACCTCGAGGTTTGATCTTGAACTGTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-1135s21c1
Sequence:CCGGGATCCCTGGGAGTGGATTATGCTCGAGCATAATCCACTCCCAGGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-568s21c1
Sequence:CCGGCAAATGGCAAGAAGGTCAAAGCTCGAGCTTTGACCTTCTTGCCATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175199.3-5390s21c1
Sequence:CCGGGAATTGCATGCACCAATATAACTCGAGTTATATTGGTGCATGCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-781s21c1
Sequence:CCGGACTCGGAGCAGCTCATCATTGCTCGAGCAATGATGAGCTGCTCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175199
HSPA12A MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 12A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-1198s21c1
Sequence:CCGGTCGAACAGTTCAAGATCAAACCTCGAGGTTTGATCTTGAACTGTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-1135s21c1
Sequence:CCGGGATCCCTGGGAGTGGATTATGCTCGAGCATAATCCACTCCCAGGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-568s21c1
Sequence:CCGGCAAATGGCAAGAAGGTCAAAGCTCGAGCTTTGACCTTCTTGCCATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175199.3-5390s21c1
Sequence:CCGGGAATTGCATGCACCAATATAACTCGAGTTATATTGGTGCATGCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-781s21c1
Sequence:CCGGACTCGGAGCAGCTCATCATTGCTCGAGCAATGATGAGCTGCTCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175199
HSPA12A MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 12A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-1198s21c1
Sequence:CCGGTCGAACAGTTCAAGATCAAACCTCGAGGTTTGATCTTGAACTGTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-1135s21c1
Sequence:CCGGGATCCCTGGGAGTGGATTATGCTCGAGCATAATCCACTCCCAGGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-568s21c1
Sequence:CCGGCAAATGGCAAGAAGGTCAAAGCTCGAGCTTTGACCTTCTTGCCATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175199.3-5390s21c1
Sequence:CCGGGAATTGCATGCACCAATATAACTCGAGTTATATTGGTGCATGCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175199.3-781s21c1
Sequence:CCGGACTCGGAGCAGCTCATCATTGCTCGAGCAATGATGAGCTGCTCCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025015
VALIDATED
HSPA12A MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 12A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_025015.2-1093s21c1
Sequence:CCGGTTACCGGAGGGACACCTTAAGCTCGAGCTTAAGGTGTCCCTCCGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025015.2-791s21c1
Sequence:CCGGACTCGGAGCAGCTCATCATTGCTCGAGCAATGATGAGCTGCTCCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_025015.2-1132s21c1
Sequence:CCGGGGCGGACCCTATGGATCTTTACTCGAGTAAAGATCCATAGGGTCCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025015.2-5109s21c1
Sequence:CCGGCAATTGTCCCTGGCATATTATCTCGAGATAATATGCCAGGGACAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025015.2-614s21c1
Sequence:CCGGCTTATGCCCTGCAGTACTTTACTCGAGTAAAGTACTGCAGGGCATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025015
VALIDATED
HSPA12A MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 12A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_025015.2-1093s21c1
Sequence:CCGGTTACCGGAGGGACACCTTAAGCTCGAGCTTAAGGTGTCCCTCCGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025015.2-791s21c1
Sequence:CCGGACTCGGAGCAGCTCATCATTGCTCGAGCAATGATGAGCTGCTCCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_025015.2-1132s21c1
Sequence:CCGGGGCGGACCCTATGGATCTTTACTCGAGTAAAGATCCATAGGGTCCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025015.2-5109s21c1
Sequence:CCGGCAATTGTCCCTGGCATATTATCTCGAGATAATATGCCAGGGACAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000237978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025015.2-614s21c1
Sequence:CCGGCTTATGCCCTGCAGTACTTTACTCGAGTAAAGTACTGCAGGGCATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025015
VALIDATED
HSPA12A MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 12A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_025015.2-1093s21c1
Sequence:CCGGTTACCGGAGGGACACCTTAAGCTCGAGCTTAAGGTGTCCCTCCGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025015.2-791s21c1
Sequence:CCGGACTCGGAGCAGCTCATCATTGCTCGAGCAATGATGAGCTGCTCCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_025015.2-1132s21c1
Sequence:CCGGGGCGGACCCTATGGATCTTTACTCGAGTAAAGATCCATAGGGTCCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237980    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025015.2-5109s21c1
Sequence:CCGGCAATTGTCCCTGGCATATTATCTCGAGATAATATGCCAGGGACAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000237978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025015.2-614s21c1
Sequence:CCGGCTTATGCCCTGCAGTACTTTACTCGAGTAAAGTACTGCAGGGCATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)