EMAIL THIS PAGE TO A FRIEND

HSPA12B

heat shock 70kD protein 12B

43 Gene Product Result for
Synonyms: C20orf60 dJ1009E24.2
UniProtKB ID: Q96MM6, D3DVX7, Q2TAK3, Q9BR52
Gene ID:
Human(116835) Summary: The protein encoded by this gene contains an atypical heat shock protein 70 (Hsp70) ATPase domain and is therefore a distant member of the mammalian Hsp70 family. This gene may be involved in susceptibility to atherosclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Mouse(72630) heat shock protein 12B
Rat(311427) heat shock protein 12B
Zebrafish(735291) heat shock protein 12B
cow(515590) heat shock 70kD protein 12B
Horse(100066324) heat shock 70kD protein 12B
domestic cat(101086894) heat shock 70kD protein 12B
dog(485793) heat shock 70kD protein 12B
domestic guinea pig(100718336) heat shock 70kD protein 12B
naked mole-rat(101699408) heat shock 70kD protein 12B
sheep(101121442) heat shock 70kD protein 12B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052970 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028306 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028306 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028306 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052970 Rosetta Predictions human pricing
NM_001107778 Rosetta Predictions rat pricing
NM_028306 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151218 predicted 2394
2 SASI_Hs01_00151219 predicted 1198
3 SASI_Hs01_00151220 predicted 580
4 SASI_Hs01_00151221 predicted 2071
5 SASI_Hs01_00151222 predicted 791
6 SASI_Hs01_00151223 predicted 2069
7 SASI_Hs01_00151224 predicted 2485
8 SASI_Hs01_00151225 predicted 513
9 SASI_Hs01_00151226 predicted 1466
10 SASI_Hs01_00151227 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232175 predicted 496
2 SASI_Rn02_00232176 predicted 878
3 SASI_Rn02_00232177 predicted 1050
4 SASI_Rn02_00232178 predicted 820
5 SASI_Rn02_00232179 predicted 469
6 SASI_Rn02_00232180 predicted 343
7 SASI_Rn02_00232181 predicted 1356
8 SASI_Rn02_00232182 predicted 1106
9 SASI_Rn02_00232183 predicted 574
10 SASI_Rn02_00232184 predicted 1504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028306 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071795 predicted 756
2 SASI_Mm01_00071796 predicted 2190
3 SASI_Mm01_00071797 predicted 1328
4 SASI_Mm01_00071798 predicted 614
5 SASI_Mm01_00071799 predicted 1465
6 SASI_Mm01_00071800 predicted 760
7 SASI_Mm01_00071801 predicted 2091
8 SASI_Mm01_00071802 predicted 2191
9 SASI_Mm01_00071803 predicted 689
10 SASI_Mm01_00071804 predicted 2159
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052970
HSPA12B MISSION shRNA Bacterial Glycerol Stock
heat shock 70kD protein 12B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052970.3-2394s21c1
Sequence:CCGGCAAGGACTGAACGGGTAAGAGCTCGAGCTCTTACCCGTTCAGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052970.3-1401s21c1
Sequence:CCGGGCAGCGTGAACTTCGTGAAGTCTCGAGACTTCACGAAGTTCACGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052970.3-2711s1c1
Sequence:CCGGCCACCCAAATATGACTGTGAACTCGAGTTCACAGTCATATTTGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-2142s1c1
Sequence:CCGGCCATCGACTTTCTTTCCAACTCTCGAGAGTTGGAAAGAAAGTCGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052970.3-2076s21c1
Sequence:CCGGAGTTTGGCGACACCGAAATTACTCGAGTAATTTCGGTGTCGCCAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-523s1c1
Sequence:CCGGCGAGAAGTTCAAGATGAAGATCTCGAGATCTTCATCTTGAACTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-1443s1c1
Sequence:CCGGGAATGTCTTGTGAAGCCATGACTCGAGTCATGGCTTCACAAGACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-514s1c1
Sequence:CCGGGCTCTACTTCGAGAAGTTCAACTCGAGTTGAACTTCTCGAAGTAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052970
HSPA12B MISSION shRNA shRNA Plasmid DNA
heat shock 70kD protein 12B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052970.3-2394s21c1
Sequence:CCGGCAAGGACTGAACGGGTAAGAGCTCGAGCTCTTACCCGTTCAGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052970.3-1401s21c1
Sequence:CCGGGCAGCGTGAACTTCGTGAAGTCTCGAGACTTCACGAAGTTCACGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052970.3-2711s1c1
Sequence:CCGGCCACCCAAATATGACTGTGAACTCGAGTTCACAGTCATATTTGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-2142s1c1
Sequence:CCGGCCATCGACTTTCTTTCCAACTCTCGAGAGTTGGAAAGAAAGTCGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052970.3-2076s21c1
Sequence:CCGGAGTTTGGCGACACCGAAATTACTCGAGTAATTTCGGTGTCGCCAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-523s1c1
Sequence:CCGGCGAGAAGTTCAAGATGAAGATCTCGAGATCTTCATCTTGAACTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-1443s1c1
Sequence:CCGGGAATGTCTTGTGAAGCCATGACTCGAGTCATGGCTTCACAAGACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-514s1c1
Sequence:CCGGGCTCTACTTCGAGAAGTTCAACTCGAGTTGAACTTCTCGAAGTAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052970
HSPA12B MISSION shRNA Lentiviral Transduction Particles
heat shock 70kD protein 12B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052970.3-2394s21c1
Sequence:CCGGCAAGGACTGAACGGGTAAGAGCTCGAGCTCTTACCCGTTCAGTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052970.3-1401s21c1
Sequence:CCGGGCAGCGTGAACTTCGTGAAGTCTCGAGACTTCACGAAGTTCACGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052970.3-2711s1c1
Sequence:CCGGCCACCCAAATATGACTGTGAACTCGAGTTCACAGTCATATTTGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-2142s1c1
Sequence:CCGGCCATCGACTTTCTTTCCAACTCTCGAGAGTTGGAAAGAAAGTCGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052970.3-2076s21c1
Sequence:CCGGAGTTTGGCGACACCGAAATTACTCGAGTAATTTCGGTGTCGCCAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-523s1c1
Sequence:CCGGCGAGAAGTTCAAGATGAAGATCTCGAGATCTTCATCTTGAACTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-1443s1c1
Sequence:CCGGGAATGTCTTGTGAAGCCATGACTCGAGTCATGGCTTCACAAGACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052970.3-514s1c1
Sequence:CCGGGCTCTACTTCGAGAAGTTCAACTCGAGTTGAACTTCTCGAAGTAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028306
VALIDATED
HSPA12B MISSION shRNA Bacterial Glycerol Stock
heat shock 70kD protein 12B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028306.2-747s1c1
Sequence:CCGGCATCTGGAAACAACCGGCTAACTCGAGTTAGCCGGTTGTTTCCAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028306.2-693s1c1
Sequence:CCGGGAGCGAGTGTATGCTTGAGAACTCGAGTTCTCAAGCATACACTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-2702s21c1
Sequence:CCGGACCTACAGGAAAGCTATAAATCTCGAGATTTATAGCTTTCCTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-685s21c1
Sequence:CCGGAGAGAGCAGAGCGAGTGTATGCTCGAGCATACACTCGCTCTGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-1263s21c1
Sequence:CCGGAGCAGCTTGGGTGGATCTAACCTCGAGGTTAGATCCACCCAAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028306.3-748s21c1
Sequence:CCGGATCTGGAAACAACCGGCTAAACTCGAGTTTAGCCGGTTGTTTCCAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-531s21c1
Sequence:CCGGGCTCTACTTTGAGAAGTTTAACTCGAGTTAAACTTCTCAAAGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028306.2-452s1c1
Sequence:CCGGCAGAAGGCATCTTTCACAGTTCTCGAGAACTGTGAAAGATGCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028306.3-2501s1c1
Sequence:CCGGGGTTAGAGTTGGCTAACTTTGCTCGAGCAAAGTTAGCCAACTCTAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028306
VALIDATED
HSPA12B MISSION shRNA shRNA Plasmid DNA
heat shock 70kD protein 12B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028306.2-747s1c1
Sequence:CCGGCATCTGGAAACAACCGGCTAACTCGAGTTAGCCGGTTGTTTCCAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028306.2-693s1c1
Sequence:CCGGGAGCGAGTGTATGCTTGAGAACTCGAGTTCTCAAGCATACACTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-2702s21c1
Sequence:CCGGACCTACAGGAAAGCTATAAATCTCGAGATTTATAGCTTTCCTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-685s21c1
Sequence:CCGGAGAGAGCAGAGCGAGTGTATGCTCGAGCATACACTCGCTCTGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-1263s21c1
Sequence:CCGGAGCAGCTTGGGTGGATCTAACCTCGAGGTTAGATCCACCCAAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028306.3-748s21c1
Sequence:CCGGATCTGGAAACAACCGGCTAAACTCGAGTTTAGCCGGTTGTTTCCAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-531s21c1
Sequence:CCGGGCTCTACTTTGAGAAGTTTAACTCGAGTTAAACTTCTCAAAGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028306.2-452s1c1
Sequence:CCGGCAGAAGGCATCTTTCACAGTTCTCGAGAACTGTGAAAGATGCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028306.3-2501s1c1
Sequence:CCGGGGTTAGAGTTGGCTAACTTTGCTCGAGCAAAGTTAGCCAACTCTAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028306
VALIDATED
HSPA12B MISSION shRNA Lentiviral Transduction Particles
heat shock 70kD protein 12B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028306.2-747s1c1
Sequence:CCGGCATCTGGAAACAACCGGCTAACTCGAGTTAGCCGGTTGTTTCCAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028306.2-693s1c1
Sequence:CCGGGAGCGAGTGTATGCTTGAGAACTCGAGTTCTCAAGCATACACTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247196    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-2702s21c1
Sequence:CCGGACCTACAGGAAAGCTATAAATCTCGAGATTTATAGCTTTCCTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-685s21c1
Sequence:CCGGAGAGAGCAGAGCGAGTGTATGCTCGAGCATACACTCGCTCTGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-1263s21c1
Sequence:CCGGAGCAGCTTGGGTGGATCTAACCTCGAGGTTAGATCCACCCAAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028306.3-748s21c1
Sequence:CCGGATCTGGAAACAACCGGCTAAACTCGAGTTTAGCCGGTTGTTTCCAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_028306.3-531s21c1
Sequence:CCGGGCTCTACTTTGAGAAGTTTAACTCGAGTTAAACTTCTCAAAGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028306.2-452s1c1
Sequence:CCGGCAGAAGGCATCTTTCACAGTTCTCGAGAACTGTGAAAGATGCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028306.3-2501s1c1
Sequence:CCGGGGTTAGAGTTGGCTAACTTTGCTCGAGCAAAGTTAGCCAACTCTAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)