EMAIL THIS PAGE TO A FRIEND

HSPA13

heat shock protein 70kDa family, member 13

127 Gene Product Result for
Synonyms: STCH
UniProtKB ID: P48723, B2R616, Q8NE40
Gene ID:
Human(6782) Summary: The protein encoded by this gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The encoded protein contains an ATPase domain and has been shown to associate with a ubiquitin-like protein. [provided by RefSeq, Jul 2008]
Mouse(110920) heat shock protein 70 family, member 13
Rat(29734) heat shock protein 70 family, member 13
sheep(101118151) heat shock protein 70kDa family, member 13
domestic guinea pig(100730913) heat shock protein 70kDa family, member 13
naked mole-rat(101712455) heat shock protein 70kDa family, member 13
Zebrafish(560481) heat shock protein 13
cow(505907) heat shock protein 70kDa family, member 13
Horse(100054291) heat shock protein 70kDa family, member 13
domestic cat(101092387) heat shock protein 70kDa family, member 13
dog(608091) heat shock protein 70kDa family, member 13
chicken(418469) heat shock protein 70kDa family, member 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030201 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030201 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030201 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006948 Rosetta Predictions human pricing
NM_019271 Rosetta Predictions rat pricing
NM_030201 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211708 predicted 1579
2 SASI_Hs01_00211710 predicted 1257
3 SASI_Hs01_00211711 predicted 977
4 SASI_Hs01_00211713 predicted 547
5 SASI_Hs01_00211714 predicted 1219
6 SASI_Hs01_00211715 predicted 1428
7 SASI_Hs01_00211716 predicted 1365
8 SASI_Hs02_00342668 predicted 757
9 SASI_Hs01_00211717 predicted 1170
10 SASI_Hs02_00342669 predicted 405
11 SASI_Hs01_00211709 predicted 762
12 SASI_Hs01_00211712 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019271 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048486 predicted 1324
2 SASI_Rn02_00262183 predicted 1027
3 SASI_Rn01_00048487 predicted 1375
4 SASI_Rn01_00048488 predicted 956
5 SASI_Rn01_00048492 predicted 640
6 SASI_Rn01_00048493 predicted 631
7 SASI_Rn01_00048494 predicted 592
8 SASI_Rn02_00262184 predicted 442
9 SASI_Rn02_00262185 predicted 1363
10 SASI_Rn02_00262186 predicted 582
11 SASI_Rn01_00048485 predicted 741
12 SASI_Rn01_00048489 predicted 417
13 SASI_Rn01_00048490 predicted 447
14 SASI_Rn01_00048491 predicted 343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336623 predicted 698
2 SASI_Mm01_00145192 predicted 431
3 SASI_Mm01_00145194 predicted 865
4 SASI_Mm01_00145195 predicted 1393
5 SASI_Mm01_00145196 predicted 968
6 SASI_Mm01_00145197 predicted 715
7 SASI_Mm01_00145198 predicted 546
8 SASI_Mm01_00145199 predicted 358
9 SASI_Mm01_00145200 predicted 642
10 SASI_Mm01_00145201 predicted 900
11 SASI_Mm01_00145193 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006948
HSPA13 MISSION shRNA Bacterial Glycerol Stock
heat shock protein 70kDa family, member 13
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-902s1c1
Sequence:CCGGGCTGTGGAAATGGTCAAATTACTCGAGTAATTTGACCATTTCCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-754s1c1
Sequence:CCGGGATGTTTCTAACCCGAGCAATCTCGAGATTGCTCGGGTTAGAAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-1130s1c1
Sequence:CCGGCGGAAACTCTTTGATACCCTTCTCGAGAAGGGTATCAAAGAGTTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006948.3-256s1c1
Sequence:CCGGCAATGATGTATATGTGGGATACTCGAGTATCCCACATATACATCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006948.3-122s1c1
Sequence:CCGGCCTAAAGTGATTGGTATTGATCTCGAGATCAATACCAATCACTTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-1273s1c1
Sequence:CCGGCCGTCAAGTCATTCAAGAGTTCTCGAGAACTCTTGAATGACTTGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-1444s21c1
Sequence:CCGGGAAATTCCCAATAAGCATTTACTCGAGTAAATGCTTATTGGGAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-412s21c1
Sequence:CCGGGAAATTGGCAGATACCCATTTCTCGAGAAATGGGTATCTGCCAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-145s21c1
Sequence:CCGGTTACCATTGCCTACTCCTAAACTCGAGTTTAGGAGTAGGCAATGGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-567s21c1
Sequence:CCGGAGTTGCCAATGCTGTCATTTCCTCGAGGAAATGACAGCATTGGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006948.4-1858s21c1
Sequence:CCGGATTAGCAGGAGCTGGTAATTACTCGAGTAATTACCAGCTCCTGCTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-853s21c1
Sequence:CCGGAGATTGCTTCAGTACTTATATCTCGAGATATAAGTACTGAAGCAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006948
HSPA13 MISSION shRNA shRNA Plasmid DNA
heat shock protein 70kDa family, member 13
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-902s1c1
Sequence:CCGGGCTGTGGAAATGGTCAAATTACTCGAGTAATTTGACCATTTCCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-754s1c1
Sequence:CCGGGATGTTTCTAACCCGAGCAATCTCGAGATTGCTCGGGTTAGAAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-1130s1c1
Sequence:CCGGCGGAAACTCTTTGATACCCTTCTCGAGAAGGGTATCAAAGAGTTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006948.3-256s1c1
Sequence:CCGGCAATGATGTATATGTGGGATACTCGAGTATCCCACATATACATCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006948.3-122s1c1
Sequence:CCGGCCTAAAGTGATTGGTATTGATCTCGAGATCAATACCAATCACTTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-1273s1c1
Sequence:CCGGCCGTCAAGTCATTCAAGAGTTCTCGAGAACTCTTGAATGACTTGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-1444s21c1
Sequence:CCGGGAAATTCCCAATAAGCATTTACTCGAGTAAATGCTTATTGGGAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-412s21c1
Sequence:CCGGGAAATTGGCAGATACCCATTTCTCGAGAAATGGGTATCTGCCAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-145s21c1
Sequence:CCGGTTACCATTGCCTACTCCTAAACTCGAGTTTAGGAGTAGGCAATGGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-567s21c1
Sequence:CCGGAGTTGCCAATGCTGTCATTTCCTCGAGGAAATGACAGCATTGGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006948.4-1858s21c1
Sequence:CCGGATTAGCAGGAGCTGGTAATTACTCGAGTAATTACCAGCTCCTGCTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-853s21c1
Sequence:CCGGAGATTGCTTCAGTACTTATATCTCGAGATATAAGTACTGAAGCAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006948
HSPA13 MISSION shRNA Lentiviral Transduction Particles
heat shock protein 70kDa family, member 13
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-902s1c1
Sequence:CCGGGCTGTGGAAATGGTCAAATTACTCGAGTAATTTGACCATTTCCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-754s1c1
Sequence:CCGGGATGTTTCTAACCCGAGCAATCTCGAGATTGCTCGGGTTAGAAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-1130s1c1
Sequence:CCGGCGGAAACTCTTTGATACCCTTCTCGAGAAGGGTATCAAAGAGTTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006948.3-256s1c1
Sequence:CCGGCAATGATGTATATGTGGGATACTCGAGTATCCCACATATACATCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006948.3-122s1c1
Sequence:CCGGCCTAAAGTGATTGGTATTGATCTCGAGATCAATACCAATCACTTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006948.3-1273s1c1
Sequence:CCGGCCGTCAAGTCATTCAAGAGTTCTCGAGAACTCTTGAATGACTTGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-1444s21c1
Sequence:CCGGGAAATTCCCAATAAGCATTTACTCGAGTAAATGCTTATTGGGAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-412s21c1
Sequence:CCGGGAAATTGGCAGATACCCATTTCTCGAGAAATGGGTATCTGCCAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-145s21c1
Sequence:CCGGTTACCATTGCCTACTCCTAAACTCGAGTTTAGGAGTAGGCAATGGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-567s21c1
Sequence:CCGGAGTTGCCAATGCTGTCATTTCCTCGAGGAAATGACAGCATTGGCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006948.4-1858s21c1
Sequence:CCGGATTAGCAGGAGCTGGTAATTACTCGAGTAATTACCAGCTCCTGCTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006948.4-853s21c1
Sequence:CCGGAGATTGCTTCAGTACTTATATCTCGAGATATAAGTACTGAAGCAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030201
VALIDATED
HSPA13 MISSION shRNA Bacterial Glycerol Stock
heat shock protein 70kDa family, member 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-2522s1c1
Sequence:CCGGCCCATGTTATTGGAAGATATACTCGAGTATATCTTCCAATAACATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-742s1c1
Sequence:CCGGGATGTTCCTAACACGAGCGATCTCGAGATCGCTCGTGTTAGGAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030201.2-542s1c1
Sequence:CCGGCCTGCAGAATTCGACCTACAACTCGAGTTGTAGGTCGAATTCTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-1133s1c1
Sequence:CCGGGCCCTCAATGAAGATCTCTTTCTCGAGAAAGAGATCTTCATTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-1195s1c1
Sequence:CCGGCCTCTTAGACAAGACGGAAATCTCGAGATTTCCGTCTTGTCTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030201
VALIDATED
HSPA13 MISSION shRNA shRNA Plasmid DNA
heat shock protein 70kDa family, member 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-2522s1c1
Sequence:CCGGCCCATGTTATTGGAAGATATACTCGAGTATATCTTCCAATAACATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-742s1c1
Sequence:CCGGGATGTTCCTAACACGAGCGATCTCGAGATCGCTCGTGTTAGGAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030201.2-542s1c1
Sequence:CCGGCCTGCAGAATTCGACCTACAACTCGAGTTGTAGGTCGAATTCTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-1133s1c1
Sequence:CCGGGCCCTCAATGAAGATCTCTTTCTCGAGAAAGAGATCTTCATTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-1195s1c1
Sequence:CCGGCCTCTTAGACAAGACGGAAATCTCGAGATTTCCGTCTTGTCTAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030201
VALIDATED
HSPA13 MISSION shRNA Lentiviral Transduction Particles
heat shock protein 70kDa family, member 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-2522s1c1
Sequence:CCGGCCCATGTTATTGGAAGATATACTCGAGTATATCTTCCAATAACATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-742s1c1
Sequence:CCGGGATGTTCCTAACACGAGCGATCTCGAGATCGCTCGTGTTAGGAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030201.2-542s1c1
Sequence:CCGGCCTGCAGAATTCGACCTACAACTCGAGTTGTAGGTCGAATTCTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-1133s1c1
Sequence:CCGGGCCCTCAATGAAGATCTCTTTCTCGAGAAAGAGATCTTCATTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030201.2-1195s1c1
Sequence:CCGGCCTCTTAGACAAGACGGAAATCTCGAGATTTCCGTCTTGTCTAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)