EMAIL THIS PAGE TO A FRIEND

HSPA1A

heat shock 70kDa protein 1A

62 Gene Product Result for
Synonyms: HSP70-1 HSP70-1A HSP70I HSP72 HSPA1
Gene ID:
Human(3303) Summary: This intronless gene encodes a 70kDa heat shock protein which is a member of the heat shock protein 70 family. In conjuction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. It is also involved in the ubiquitin-proteasome pathway through interaction with the AU-rich element RNA-binding protein 1. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which encode similar proteins. [provided by RefSeq, Jul 2008]
Mouse(193740) heat shock protein 1A
Rat(24472) heat shock 70kD protein 1A
sheep(100913152) heat shock 70kDa protein 1A
Domestic Rabbit(100354037) heat shock 70kDa protein 1A
cow(281825) heat shock 70kDa protein 1A
cow(282254) heat shock 70kDa protein 1A
Horse(100050827) heat shock 70kDa protein 1A
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200714 Anti-Heat Shock Protein 70 (HSP70) antibody, Mouse monoclonal clone BRM-22, purified from hybridoma cell culture dog, human, fish, rabbit, mouse, chicken, rat, insect, sea urchin, monkey, plant, bovine
dot blot, ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4200797 Anti-HSP70 antibody produced in rabbit IgG fraction of antiserum New mouse, monkey, bovine, rat, canine, chicken, human
immunoprecipitation (IP), western blot pricing
AV33096 Anti-HSPA1A antibody produced in rabbit IgG fraction of antiserum guinea pig, zebrafish, mouse, horse, human, goat, Caenorhabditis elegans, canine, rat, rabbit, sheep
western blot pricing
SAB2700846 Anti-HSPA1A antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB2701085 Anti-HSPA1A antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB2107600 Anti-HSPA1A antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
HPA052504 Anti-HSPA1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
H5147 Monoclonal Anti-Heat Shock Protein 70 antibody produced in mouse clone BRM-22, ascites fluid plant, bovine, guinea pig, nematode, human, Drosophila, rabbit, rat, chicken, hamster
electron microscopy, ELISA, immunohistochemistry, microarray, western blot pricing
SAB3701436 Monoclonal Anti-Hsc70 (Hsp73) antibody produced in mouse clone N27F3-4, purified immunoglobulin chicken, rat, Caenorhabditis elegans, human, salmon, mouse, canine, Drosophila, bovine, beluga, carp
ELISA, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0805 AQUA Peptide VEIIANDQGN[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005345 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_207062 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_207062 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_207062 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_010479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148311 MISSION® esiRNA esiRNA human HSPA1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005345 siRNAs that have been validated in the lab human pricing
NM_031971 Rosetta Predictions rat pricing
NM_010479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005345 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051449 validated 1954
2 SASI_Hs01_00051448 predicted 2123
3 SASI_Hs01_00051454 predicted 1939
4 SASI_Hs01_00051456 predicted 1935
5 SASI_Hs01_00051450 predicted 378
6 SASI_Hs01_00051451 predicted 1047
7 SASI_Hs01_00051452 predicted 463
8 SASI_Hs01_00051453 predicted 2157
9 SASI_Hs01_00051455 predicted 1623
10 SASI_Hs01_00051457 predicted 1818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040550 predicted 2158
2 SASI_Rn01_00040551 predicted 2222
3 SASI_Rn02_00265356 predicted 2135
4 SASI_Rn02_00265357 predicted 2111
5 SASI_Rn01_00040552 predicted 2077
6 SASI_Rn02_00265358 predicted 2184
7 SASI_Rn02_00265359 predicted 2190
8 SASI_Rn01_00040555 predicted 2215
9 SASI_Rn01_00040556 predicted 1397
10 SASI_Rn02_00265360 predicted 468
11 SASI_Rn01_00040549 predicted 1798
12 SASI_Rn01_00040553 predicted 663
13 SASI_Rn01_00040554 predicted 760
14 SASI_Rn01_00040557 predicted 1246
15 SASI_Rn01_00040558 predicted 1992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137710 predicted 2212
2 SASI_Mm02_00318707 predicted 2212
3 SASI_Mm01_00137712 predicted 2288
4 SASI_Mm01_00137713 predicted 2255
5 SASI_Mm01_00137714 predicted 393
6 SASI_Mm01_00137715 predicted 2437
7 SASI_Mm01_00137716 predicted 1951
8 SASI_Mm01_00137717 predicted 1454
9 SASI_Mm01_00137718 predicted 1850
10 SASI_Mm02_00318708 predicted 2267
11 SASI_Mm01_00137709 predicted 2289
12 SASI_Mm01_00137711 predicted 2410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005345
HSPA1A MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 1A
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005345.4-2126s1c1
Sequence:CCGGGCCTTTCCAAGATTGCTGTTTCTCGAGAAACAGCAATCTTGGAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-920s1c1
Sequence:CCGGCGTGGAGGAGTTCAAGAGAAACTCGAGTTTCTCTTGAACTCCTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-1539s1c1
Sequence:CCGGGCCATGACGAAAGACAACAATCTCGAGATTGTTGTCTTTCGTCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-566s1c1
Sequence:CCGGGCTGACCAAGATGAAGGAGATCTCGAGATCTCCTTCATCTTGGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-2101s1c1
Sequence:CCGGCCACCATTGAGGAGGTAGATTCTCGAGAATCTACCTCCTCAATGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2246s21c1
Sequence:CCGGTCAATTTCCTGTGTTTGCAATCTCGAGATTGCAAACACAGGAAATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2254s21c1
Sequence:CCGGCTGTGTTTGCAATGTTGAAATCTCGAGATTTCAACATTGCAAACACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2197s21c1
Sequence:CCGGTTTGGAGCTTCAAGACTTTGCCTCGAGGCAAAGTCTTGAAGCTCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2210s21c1
Sequence:CCGGGACTTTGCATTTCCTAGTATTCTCGAGAATACTAGGAAATGCAAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2232s21c1
Sequence:CCGGCTGTTTGTCAGTTCTCAATTTCTCGAGAAATTGAGAACTGACAAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005345.5-2148s21c1
Sequence:CCGGCACCATTGAGGAGGTAGATTACTCGAGTAATCTACCTCCTCAATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005345.5-1802s21c1
Sequence:CCGGAGGAGGCGGAGAAGTACAAAGCTCGAGCTTTGTACTTCTCCGCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005345.5-818s21c1
Sequence:CCGGAGCGCAACGTGCTCATCTTTGCTCGAGCAAAGATGAGCACGTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005345
HSPA1A MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 1A
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005345.4-2126s1c1
Sequence:CCGGGCCTTTCCAAGATTGCTGTTTCTCGAGAAACAGCAATCTTGGAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-920s1c1
Sequence:CCGGCGTGGAGGAGTTCAAGAGAAACTCGAGTTTCTCTTGAACTCCTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-1539s1c1
Sequence:CCGGGCCATGACGAAAGACAACAATCTCGAGATTGTTGTCTTTCGTCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-566s1c1
Sequence:CCGGGCTGACCAAGATGAAGGAGATCTCGAGATCTCCTTCATCTTGGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-2101s1c1
Sequence:CCGGCCACCATTGAGGAGGTAGATTCTCGAGAATCTACCTCCTCAATGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2246s21c1
Sequence:CCGGTCAATTTCCTGTGTTTGCAATCTCGAGATTGCAAACACAGGAAATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2254s21c1
Sequence:CCGGCTGTGTTTGCAATGTTGAAATCTCGAGATTTCAACATTGCAAACACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2197s21c1
Sequence:CCGGTTTGGAGCTTCAAGACTTTGCCTCGAGGCAAAGTCTTGAAGCTCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2210s21c1
Sequence:CCGGGACTTTGCATTTCCTAGTATTCTCGAGAATACTAGGAAATGCAAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2232s21c1
Sequence:CCGGCTGTTTGTCAGTTCTCAATTTCTCGAGAAATTGAGAACTGACAAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005345.5-2148s21c1
Sequence:CCGGCACCATTGAGGAGGTAGATTACTCGAGTAATCTACCTCCTCAATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005345.5-1802s21c1
Sequence:CCGGAGGAGGCGGAGAAGTACAAAGCTCGAGCTTTGTACTTCTCCGCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005345.5-818s21c1
Sequence:CCGGAGCGCAACGTGCTCATCTTTGCTCGAGCAAAGATGAGCACGTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005345
HSPA1A MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 1A
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005345.4-2126s1c1
Sequence:CCGGGCCTTTCCAAGATTGCTGTTTCTCGAGAAACAGCAATCTTGGAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-920s1c1
Sequence:CCGGCGTGGAGGAGTTCAAGAGAAACTCGAGTTTCTCTTGAACTCCTCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-1539s1c1
Sequence:CCGGGCCATGACGAAAGACAACAATCTCGAGATTGTTGTCTTTCGTCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-566s1c1
Sequence:CCGGGCTGACCAAGATGAAGGAGATCTCGAGATCTCCTTCATCTTGGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005345.4-2101s1c1
Sequence:CCGGCCACCATTGAGGAGGTAGATTCTCGAGAATCTACCTCCTCAATGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2246s21c1
Sequence:CCGGTCAATTTCCTGTGTTTGCAATCTCGAGATTGCAAACACAGGAAATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2254s21c1
Sequence:CCGGCTGTGTTTGCAATGTTGAAATCTCGAGATTTCAACATTGCAAACACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2197s21c1
Sequence:CCGGTTTGGAGCTTCAAGACTTTGCCTCGAGGCAAAGTCTTGAAGCTCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2210s21c1
Sequence:CCGGGACTTTGCATTTCCTAGTATTCTCGAGAATACTAGGAAATGCAAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342860    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005345.5-2232s21c1
Sequence:CCGGCTGTTTGTCAGTTCTCAATTTCTCGAGAAATTGAGAACTGACAAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005345.5-2148s21c1
Sequence:CCGGCACCATTGAGGAGGTAGATTACTCGAGTAATCTACCTCCTCAATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005345.5-1802s21c1
Sequence:CCGGAGGAGGCGGAGAAGTACAAAGCTCGAGCTTTGTACTTCTCCGCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005345.5-818s21c1
Sequence:CCGGAGCGCAACGTGCTCATCTTTGCTCGAGCAAAGATGAGCACGTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_207062
HSPA1A MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-183s1c1
Sequence:CCGGGAACCCGCAGAACACCGTGTTCTCGAGAACACGGTGTTCTGCGGGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-1626s1c1
Sequence:CCGGCGAGTCCTATGCCTTCAACATCTCGAGATGTTGAAGGCATAGGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-369s1c1
Sequence:CCGGGCTGACGAAGATGAAGGAGATCTCGAGATCTCCTTCATCTTCGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-1071s1c1
Sequence:CCGGCGACCTGAACAAGAGCATCAACTCGAGTTGATGCTCTTGTTCAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-495s1c1
Sequence:CCGGCGGTCTAAACGTGCTGCGGATCTCGAGATCCGCAGCACGTTTAGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_207062
HSPA1A MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-183s1c1
Sequence:CCGGGAACCCGCAGAACACCGTGTTCTCGAGAACACGGTGTTCTGCGGGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-1626s1c1
Sequence:CCGGCGAGTCCTATGCCTTCAACATCTCGAGATGTTGAAGGCATAGGACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-369s1c1
Sequence:CCGGGCTGACGAAGATGAAGGAGATCTCGAGATCTCCTTCATCTTCGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-1071s1c1
Sequence:CCGGCGACCTGAACAAGAGCATCAACTCGAGTTGATGCTCTTGTTCAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-495s1c1
Sequence:CCGGCGGTCTAAACGTGCTGCGGATCTCGAGATCCGCAGCACGTTTAGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_207062
HSPA1A MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-183s1c1
Sequence:CCGGGAACCCGCAGAACACCGTGTTCTCGAGAACACGGTGTTCTGCGGGTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-1626s1c1
Sequence:CCGGCGAGTCCTATGCCTTCAACATCTCGAGATGTTGAAGGCATAGGACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-369s1c1
Sequence:CCGGGCTGACGAAGATGAAGGAGATCTCGAGATCTCCTTCATCTTCGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-1071s1c1
Sequence:CCGGCGACCTGAACAAGAGCATCAACTCGAGTTGATGCTCTTGTTCAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_207062.2-495s1c1
Sequence:CCGGCGGTCTAAACGTGCTGCGGATCTCGAGATCCGCAGCACGTTTAGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010479
HSPA1A MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 1A
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000422257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010479.2-2308s21c1
Sequence:CCGGTGTATTGCACGTGGGCTTTATCTCGAGATAAAGCCCACGTGCAATACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010479.2-2233s21c1
Sequence:CCGGAGTACTTCACTCCTTAGTTTGCTCGAGCAAACTAAGGAGTGAAGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010479.2-2622s21c1
Sequence:CCGGTGCTTCTCCTTGCGTTTATAACTCGAGTTATAAACGCAAGGAGAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010479
HSPA1A MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 1A
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000422257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010479.2-2308s21c1
Sequence:CCGGTGTATTGCACGTGGGCTTTATCTCGAGATAAAGCCCACGTGCAATACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010479.2-2233s21c1
Sequence:CCGGAGTACTTCACTCCTTAGTTTGCTCGAGCAAACTAAGGAGTGAAGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010479.2-2622s21c1
Sequence:CCGGTGCTTCTCCTTGCGTTTATAACTCGAGTTATAAACGCAAGGAGAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010479
HSPA1A MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 1A
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000422257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010479.2-2308s21c1
Sequence:CCGGTGTATTGCACGTGGGCTTTATCTCGAGATAAAGCCCACGTGCAATACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010479.2-2233s21c1
Sequence:CCGGAGTACTTCACTCCTTAGTTTGCTCGAGCAAACTAAGGAGTGAAGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010479.2-2622s21c1
Sequence:CCGGTGCTTCTCCTTGCGTTTATAACTCGAGTTATAAACGCAAGGAGAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)