EMAIL THIS PAGE TO A FRIEND

HSPA1B

heat shock 70kDa protein 1B

74 Gene Product Result for
Synonyms: HSP70-1B HSP70-2
Gene ID:
Human(3304) Summary: This intronless gene encodes a 70kDa heat shock protein which is a member of the heat shock protein 70 family. In conjuction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. It is also involved in the ubiquitin-proteasome pathway through interaction with the AU-rich element RNA-binding protein 1. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which encode similar proteins. [provided by RefSeq, Jul 2008]
Mouse(15511) heat shock protein 1B
Rat(294254) heat shock 70kD protein 1B (mapped)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2702384 Anti-HSP70 1B antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2702387 Anti-HSP70 1B antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
H5147 Monoclonal Anti-Heat Shock Protein 70 antibody produced in mouse clone BRM-22, ascites fluid plant, bovine, guinea pig, nematode, human, Drosophila, rabbit, rat, chicken, hamster
electron microscopy, ELISA, immunohistochemistry, microarray, western blot pricing
WH0003304M2 Monoclonal Anti-HSPA1B antibody produced in mouse clone 3B7, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing
SAB1403949 Monoclonal Anti-HSPA1B antibody produced in mouse clone 2D11, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunohistochemistry, proximity ligation assay, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0805 AQUA Peptide VEIIANDQGN[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005346 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005346 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005346 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005346 siRNAs that have been validated in the lab human pricing
NM_212504 Rosetta Predictions rat pricing
NM_010478 Rosetta Predictions mouse pricing
XM_001002795 Rosetta Predictions mouse pricing
XM_001002803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005346 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101768 validated 1976
2 SASI_Hs01_00101776 predicted 1909
3 SASI_Hs02_00339423 predicted 1959
4 SASI_Hs02_00339424 predicted 1954
5 SASI_Hs01_00101767 predicted 2142
6 SASI_Hs01_00101769 predicted 1922
7 SASI_Hs01_00101770 predicted 394
8 SASI_Hs01_00101771 predicted 1072
9 SASI_Hs01_00101773 predicted 2180
10 SASI_Hs01_00101774 predicted 479
11 SASI_Hs01_00101772 predicted 2112
12 SASI_Hs01_00101775 predicted 2115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270485 predicted 4124
2 SASI_Rn02_00270486 predicted 4194
3 SASI_Rn02_00270487 predicted 4104
4 SASI_Rn02_00270488 predicted 4078
5 SASI_Rn02_00270489 predicted 4052
6 SASI_Rn02_00270490 predicted 4161
7 SASI_Rn02_00270491 predicted 4158
8 SASI_Rn02_00270492 predicted 4195
9 SASI_Rn02_00270493 predicted 3370
10 SASI_Rn02_00270494 predicted 2441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318702 predicted 710
2 SASI_Mm01_00093623 predicted 586
3 SASI_Mm02_00318703 predicted 2564
4 SASI_Mm01_00093624 predicted 523
5 SASI_Mm01_00093625 predicted 804
6 SASI_Mm01_00093626 predicted 501
7 SASI_Mm02_00318704 predicted 1957
8 SASI_Mm02_00318705 predicted 1448
9 SASI_Mm01_00093629 predicted 516
10 SASI_Mm02_00318706 predicted 412
11 SASI_Mm01_00093622 predicted 487
12 SASI_Mm01_00093627 predicted 1224
13 SASI_Mm01_00093628 predicted 1629
14 SASI_Mm01_00093630 predicted 217
15 SASI_Mm01_00093631 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214223 predicted 1017
2 SASI_Mm01_00214224 predicted 940
3 SASI_Mm01_00214225 predicted 2873
4 SASI_Mm01_00214226 predicted 878
5 SASI_Mm01_00214227 predicted 1110
6 SASI_Mm01_00214228 predicted 852
7 SASI_Mm01_00214229 predicted 2259
8 SASI_Mm01_00214230 predicted 1753
9 SASI_Mm01_00214231 predicted 873
10 SASI_Mm01_00214232 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209610 predicted 1059
2 SASI_Mm01_00209611 predicted 937
3 SASI_Mm01_00209612 predicted 2916
4 SASI_Mm01_00209613 predicted 883
5 SASI_Mm01_00209614 predicted 1162
6 SASI_Mm01_00209615 predicted 847
7 SASI_Mm01_00209616 predicted 2306
8 SASI_Mm01_00209617 predicted 1801
9 SASI_Mm01_00209618 predicted 877
10 SASI_Mm01_00209619 predicted 768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010478
VALIDATED
HSPA1B MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 1B
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010478.2-2483s21c1
Sequence:CCGGGTAGCCTGGGAAGACATATAGCTCGAGCTATATGTCTTCCCAGGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010478.2-2230s21c1
Sequence:CCGGCGATTACTGTCAAGGTTATTTCTCGAGAAATAACCTTGACAGTAATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010478.2-2570s21c1
Sequence:CCGGACTGTGTACTACATAACTTTACTCGAGTAAAGTTATGTAGTACACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010478.2-2610s21c1
Sequence:CCGGTTATCTGCTTGTCCATGTTAACTCGAGTTAACATGGACAAGCAGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-1623s1c1
Sequence:CCGGGCTCGAATCCTATGCCTTCAACTCGAGTTGAAGGCATAGGATTCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-1488s1c1
Sequence:CCGGCAAGGCCAACAAGATCACCATCTCGAGATGGTGATCTTGTTGGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-639s1c1
Sequence:CCGGCGACGGCATCTTCGAGGTGAACTCGAGTTCACCTCGAAGATGCCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-309s1c1
Sequence:CCGGGCAGGTGAACTACAAGGGCGACTCGAGTCGCCCTTGTAGTTCACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-411s1c1
Sequence:CCGGCCCGGTGACCAACGCGGTGATCTCGAGATCACCGCGTTGGTCACCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010478
VALIDATED
HSPA1B MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 1B
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010478.2-2483s21c1
Sequence:CCGGGTAGCCTGGGAAGACATATAGCTCGAGCTATATGTCTTCCCAGGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010478.2-2230s21c1
Sequence:CCGGCGATTACTGTCAAGGTTATTTCTCGAGAAATAACCTTGACAGTAATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010478.2-2570s21c1
Sequence:CCGGACTGTGTACTACATAACTTTACTCGAGTAAAGTTATGTAGTACACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010478.2-2610s21c1
Sequence:CCGGTTATCTGCTTGTCCATGTTAACTCGAGTTAACATGGACAAGCAGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-1623s1c1
Sequence:CCGGGCTCGAATCCTATGCCTTCAACTCGAGTTGAAGGCATAGGATTCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-1488s1c1
Sequence:CCGGCAAGGCCAACAAGATCACCATCTCGAGATGGTGATCTTGTTGGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-639s1c1
Sequence:CCGGCGACGGCATCTTCGAGGTGAACTCGAGTTCACCTCGAAGATGCCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-309s1c1
Sequence:CCGGGCAGGTGAACTACAAGGGCGACTCGAGTCGCCCTTGTAGTTCACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-411s1c1
Sequence:CCGGCCCGGTGACCAACGCGGTGATCTCGAGATCACCGCGTTGGTCACCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010478
VALIDATED
HSPA1B MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 1B
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010478.2-2483s21c1
Sequence:CCGGGTAGCCTGGGAAGACATATAGCTCGAGCTATATGTCTTCCCAGGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010478.2-2230s21c1
Sequence:CCGGCGATTACTGTCAAGGTTATTTCTCGAGAAATAACCTTGACAGTAATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347340    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010478.2-2570s21c1
Sequence:CCGGACTGTGTACTACATAACTTTACTCGAGTAAAGTTATGTAGTACACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010478.2-2610s21c1
Sequence:CCGGTTATCTGCTTGTCCATGTTAACTCGAGTTAACATGGACAAGCAGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-1623s1c1
Sequence:CCGGGCTCGAATCCTATGCCTTCAACTCGAGTTGAAGGCATAGGATTCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-1488s1c1
Sequence:CCGGCAAGGCCAACAAGATCACCATCTCGAGATGGTGATCTTGTTGGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-639s1c1
Sequence:CCGGCGACGGCATCTTCGAGGTGAACTCGAGTTCACCTCGAAGATGCCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-309s1c1
Sequence:CCGGGCAGGTGAACTACAAGGGCGACTCGAGTCGCCCTTGTAGTTCACCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010478.1-411s1c1
Sequence:CCGGCCCGGTGACCAACGCGGTGATCTCGAGATCACCGCGTTGGTCACCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005346
HSPA1B MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005346.3-2133s1c1
Sequence:CCGGGCCTTTGTTCTTTAGTATGTTCTCGAGAACATACTAAAGAACAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-2107s1c1
Sequence:CCGGCCTACCATTGAGGAGGTGGATCTCGAGATCCACCTCCTCAATGGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-1074s1c1
Sequence:CCGGCATCGACTTCTACACGTCCATCTCGAGATGGACGTGTAGAAGTCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-900s1c1
Sequence:CCGGCTTTGACAACAGGCTGGTGAACTCGAGTTCACCAGCCTGTTGTCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-1704s1c1
Sequence:CCGGGATCACCATCACCAACGACAACTCGAGTTGTCGTTGGTGATGGTGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005346
HSPA1B MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005346.3-2133s1c1
Sequence:CCGGGCCTTTGTTCTTTAGTATGTTCTCGAGAACATACTAAAGAACAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-2107s1c1
Sequence:CCGGCCTACCATTGAGGAGGTGGATCTCGAGATCCACCTCCTCAATGGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-1074s1c1
Sequence:CCGGCATCGACTTCTACACGTCCATCTCGAGATGGACGTGTAGAAGTCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-900s1c1
Sequence:CCGGCTTTGACAACAGGCTGGTGAACTCGAGTTCACCAGCCTGTTGTCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-1704s1c1
Sequence:CCGGGATCACCATCACCAACGACAACTCGAGTTGTCGTTGGTGATGGTGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005346
HSPA1B MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005346.3-2133s1c1
Sequence:CCGGGCCTTTGTTCTTTAGTATGTTCTCGAGAACATACTAAAGAACAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-2107s1c1
Sequence:CCGGCCTACCATTGAGGAGGTGGATCTCGAGATCCACCTCCTCAATGGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-1074s1c1
Sequence:CCGGCATCGACTTCTACACGTCCATCTCGAGATGGACGTGTAGAAGTCGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-900s1c1
Sequence:CCGGCTTTGACAACAGGCTGGTGAACTCGAGTTCACCAGCCTGTTGTCAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005346.3-1704s1c1
Sequence:CCGGGATCACCATCACCAACGACAACTCGAGTTGTCGTTGGTGATGGTGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)