EMAIL THIS PAGE TO A FRIEND

HSPA1L

heat shock 70kDa protein 1-like

54 Gene Product Result for
Synonyms: HSP70-1L HSP70-HOM HSP70T hum70t
Gene ID:
Human(3305) Summary: This gene encodes a 70kDa heat shock protein. In conjunction with other heat shock proteins, this protein stabilizes existing proteins against aggregation and mediates the folding of newly translated proteins in the cytosol and in organelles. The gene is located in the major histocompatibility complex class III region, in a cluster with two closely related genes which also encode isoforms of the 70kDa heat shock protein. [provided by RefSeq, Jul 2008]
Mouse(15482) heat shock protein 1-like
Rat(24963) heat shock protein 1-like
sheep(101117117) heat shock 70kDa protein 1-like
domestic guinea pig(100717481) heat shock 70kDa protein 1-like
naked mole-rat(101699805) heat shock 70kDa protein 1-like
cow(540190) heat shock 70kDa protein 1-like
dog(474850) heat shock 70kDa protein 1-like
domestic cat(101091022) heat shock 70kDa protein 1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0805 AQUA Peptide VEIIANDQGN[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013558 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013558 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013558 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005527 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005527 Rosetta Predictions human pricing
NM_212546 Rosetta Predictions rat pricing
NM_013558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227069 predicted 670
2 SASI_Hs01_00227070 predicted 1808
3 SASI_Hs01_00227071 predicted 1947
4 SASI_Hs01_00227072 predicted 1152
5 SASI_Hs01_00227073 predicted 2085
6 SASI_Hs01_00227074 predicted 546
7 SASI_Hs01_00227076 predicted 1979
8 SASI_Hs01_00227077 predicted 2124
9 SASI_Hs01_00227078 predicted 1912
10 SASI_Hs02_00339748 predicted 437
11 SASI_Hs01_00227075 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270571 predicted 1386
2 SASI_Rn01_00093749 predicted 432
3 SASI_Rn01_00093750 predicted 372
4 SASI_Rn01_00093751 predicted 1539
5 SASI_Rn01_00093752 predicted 463
6 SASI_Rn01_00093754 predicted 2065
7 SASI_Rn01_00093756 predicted 654
8 SASI_Rn01_00093757 predicted 1783
9 SASI_Rn01_00093758 predicted 1736
10 SASI_Rn02_00270572 predicted 1085
11 SASI_Rn01_00093753 predicted 309
12 SASI_Rn01_00093755 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162417 predicted 447
2 SASI_Mm01_00162418 predicted 444
3 SASI_Mm01_00162419 predicted 677
4 SASI_Mm02_00322285 predicted 1549
5 SASI_Mm01_00162420 predicted 1799
6 SASI_Mm01_00162422 predicted 2070
7 SASI_Mm01_00162423 predicted 1937
8 SASI_Mm01_00162424 predicted 428
9 SASI_Mm01_00162425 predicted 418
10 SASI_Mm01_00162426 predicted 1564
11 SASI_Mm01_00162421 predicted 1118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013558
HSPA1L MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-1522s1c1
Sequence:CCGGCGCTTTGACTTGACTGGAATACTCGAGTATTCCAGTCAAGTCAAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-1002s1c1
Sequence:CCGGCGACTCTTTATATGAGGGCATCTCGAGATGCCCTCATATAAAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-2047s1c1
Sequence:CCGGCCTACCATCGAGGAAGTAGATCTCGAGATCTACTTCCTCGATGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-452s1c1
Sequence:CCGGCCAAGGTGATGGTGTCCTATACTCGAGTATAGGACACCATCACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-364s1c1
Sequence:CCGGCGTCTAATTGGCAGGAAGTTTCTCGAGAAACTTCCTGCCAATTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013558
HSPA1L MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-1522s1c1
Sequence:CCGGCGCTTTGACTTGACTGGAATACTCGAGTATTCCAGTCAAGTCAAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-1002s1c1
Sequence:CCGGCGACTCTTTATATGAGGGCATCTCGAGATGCCCTCATATAAAGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-2047s1c1
Sequence:CCGGCCTACCATCGAGGAAGTAGATCTCGAGATCTACTTCCTCGATGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-452s1c1
Sequence:CCGGCCAAGGTGATGGTGTCCTATACTCGAGTATAGGACACCATCACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-364s1c1
Sequence:CCGGCGTCTAATTGGCAGGAAGTTTCTCGAGAAACTTCCTGCCAATTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013558
HSPA1L MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-1522s1c1
Sequence:CCGGCGCTTTGACTTGACTGGAATACTCGAGTATTCCAGTCAAGTCAAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-1002s1c1
Sequence:CCGGCGACTCTTTATATGAGGGCATCTCGAGATGCCCTCATATAAAGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-2047s1c1
Sequence:CCGGCCTACCATCGAGGAAGTAGATCTCGAGATCTACTTCCTCGATGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-452s1c1
Sequence:CCGGCCAAGGTGATGGTGTCCTATACTCGAGTATAGGACACCATCACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013558.1-364s1c1
Sequence:CCGGCGTCTAATTGGCAGGAAGTTTCTCGAGAAACTTCCTGCCAATTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005527
HSPA1L MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 1-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-1840s1c1
Sequence:CCGGGCAAGATTAGTGAGTCTGATACTCGAGTATCAGACTCACTAATCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-2059s1c1
Sequence:CCGGCCACAATTGAAGAAGTAGATTCTCGAGAATCTACTTCTTCAATTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-699s1c1
Sequence:CCGGGCCATTGCCTATGGTTTAGATCTCGAGATCTAAACCATAGGCAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-506s1c1
Sequence:CCGGCCCTGAGGAAATCTCTTCGATCTCGAGATCGAAGAGATTTCCTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-1131s1c1
Sequence:CCGGGCCAAGATGGATAAGGCTAAACTCGAGTTTAGCCTTATCCATCTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005527
HSPA1L MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 1-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-1840s1c1
Sequence:CCGGGCAAGATTAGTGAGTCTGATACTCGAGTATCAGACTCACTAATCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-2059s1c1
Sequence:CCGGCCACAATTGAAGAAGTAGATTCTCGAGAATCTACTTCTTCAATTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-699s1c1
Sequence:CCGGGCCATTGCCTATGGTTTAGATCTCGAGATCTAAACCATAGGCAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-506s1c1
Sequence:CCGGCCCTGAGGAAATCTCTTCGATCTCGAGATCGAAGAGATTTCCTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-1131s1c1
Sequence:CCGGGCCAAGATGGATAAGGCTAAACTCGAGTTTAGCCTTATCCATCTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005527
HSPA1L MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 1-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-1840s1c1
Sequence:CCGGGCAAGATTAGTGAGTCTGATACTCGAGTATCAGACTCACTAATCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-2059s1c1
Sequence:CCGGCCACAATTGAAGAAGTAGATTCTCGAGAATCTACTTCTTCAATTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-699s1c1
Sequence:CCGGGCCATTGCCTATGGTTTAGATCTCGAGATCTAAACCATAGGCAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-506s1c1
Sequence:CCGGCCCTGAGGAAATCTCTTCGATCTCGAGATCGAAGAGATTTCCTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005527.2-1131s1c1
Sequence:CCGGGCCAAGATGGATAAGGCTAAACTCGAGTTTAGCCTTATCCATCTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)