EMAIL THIS PAGE TO A FRIEND

HSPA2

heat shock 70kDa protein 2

87 Gene Product Result for
Synonyms: HSP70-2 HSP70-3
UniProtKB ID: P54652, Q15508, Q53XM3, Q9UE78
Gene ID:
Mouse(15512) heat shock protein 2
Rat(60460) heat shock protein 2
chicken(423504) heat shock 70kDa protein 2
cow(281826) heat shock 70kDa protein 2
cow(281827) heat shock 70kDa protein 2
domestic cat(101088003) heat shock 70kDa protein 2
dog(480355) heat shock 70kDa protein 2
domestic guinea pig(100713571) heat shock 70kDa protein 2
naked mole-rat(101706305) heat shock 70kDa protein 2
sheep(101110063) heat shock 70kDa protein 2
Domestic Rabbit(100352959) heat shock 70kDa protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405970 Anti-HSPA2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA000798 Anti-HSPA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing
SAB2101095 Anti-HSPA2 antibody produced in rabbit affinity isolated antibody mouse, canine, guinea pig, bovine, human, rat, rabbit
western blot pricing
SAB1410666 Anti-HSPA2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
SAB5200001 Monoclonal Anti-HSPA1A/HSPA8 antibody produced in mouse clone BB70, 1 mg/mL, purified immunoglobulin hamster, dog, bovine, yeast, fish, mouse, beluga, rabbit, rat, human, Xenopus, Drosophila, pig, sheep, chicken, guinea pig
immunohistochemistry, immunoprecipitation (IP), western blot pricing
WH0003306M4 Monoclonal Anti-HSPA2 antibody produced in mouse clone 3A11-1A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403951 Monoclonal Anti-HSPA2 antibody produced in mouse clone 3H7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1409217 Monoclonal Anti-HSPA2 antibody produced in mouse clone 2D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0829 AQUA Peptide FEELNADLF[R] human, mouse, rat pricing
AQ0805 AQUA Peptide VEIIANDQGN[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021979 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021979 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021979 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021979 Rosetta Predictions human pricing
NM_021863 Rosetta Predictions rat pricing
NM_001002012 Rosetta Predictions mouse pricing
NM_008301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021979 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355333 predicted 722
2 SASI_Hs02_00355334 predicted 1958
3 SASI_Hs01_00071129 predicted 1245
4 SASI_Hs01_00071131 predicted 2012
5 SASI_Hs02_00355335 predicted 1856
6 SASI_Hs02_00355336 predicted 2014
7 SASI_Hs02_00355337 predicted 1862
8 SASI_Hs02_00355338 predicted 1150
9 SASI_Hs01_00071124 predicted 961
10 SASI_Hs01_00071125 predicted 805
11 SASI_Hs01_00071123 predicted 1213
12 SASI_Hs01_00071126 predicted 435
13 SASI_Hs01_00071127 predicted 413
14 SASI_Hs01_00071128 predicted 1274
15 SASI_Hs01_00071130 predicted 292
16 SASI_Hs01_00071132 predicted 1519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108532 predicted 611
2 SASI_Rn02_00262889 predicted 853
3 SASI_Rn01_00108533 predicted 1471
4 SASI_Rn01_00108535 predicted 1546
5 SASI_Rn01_00108536 predicted 472
6 SASI_Rn01_00108537 predicted 415
7 SASI_Rn01_00108538 predicted 660
8 SASI_Rn02_00262890 predicted 1806
9 SASI_Rn01_00108539 predicted 995
10 SASI_Rn01_00108540 predicted 1274
11 SASI_Rn01_00108534 predicted 546
12 SASI_Rn01_00108541 predicted 1328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187492 predicted 1248
2 SASI_Mm01_00187493 predicted 1139
3 SASI_Mm01_00187495 predicted 690
4 SASI_Mm01_00187496 predicted 1804
5 SASI_Mm01_00187497 predicted 1477
6 SASI_Mm02_00286275 predicted 1109
7 SASI_Mm01_00187498 predicted 420
8 SASI_Mm02_00286276 predicted 978
9 SASI_Mm01_00187499 predicted 341
10 SASI_Mm01_00187500 predicted 997
11 SASI_Mm01_00187494 predicted 816
12 SASI_Mm01_00187501 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027403 predicted 1296
2 SASI_Mm01_00027404 predicted 1184
3 SASI_Mm01_00027406 predicted 744
4 SASI_Mm01_00027407 predicted 1851
5 SASI_Mm01_00027408 predicted 1526
6 SASI_Mm02_00313591 predicted 1155
7 SASI_Mm01_00027409 predicted 465
8 SASI_Mm02_00313592 predicted 1021
9 SASI_Mm01_00027410 predicted 388
10 SASI_Mm01_00027411 predicted 1040
11 SASI_Mm01_00027405 predicted 858
12 SASI_Mm01_00027412 predicted 781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021979
VALIDATED
HSPA2 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-1708s1c1
Sequence:CCGGCCTGGAGTCCTATACCTACAACTCGAGTTGTAGGTATAGGACTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-1514s1c1
Sequence:CCGGACCTTCGACATTGACGCCAATCTCGAGATTGGCGTCAATGTCGAAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-655s1c1
Sequence:CCGGCGGCGAGAAGAACGTGCTCATCTCGAGATGAGCACGTTCTTCTCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-291s1c1
Sequence:CCGGAGAGGCTGATTGGACGGAAATCTCGAGATTTCCGTCCAATCAGCCTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-1217s1c1
Sequence:CCGGGCCATCCTCATCGGCGACAAACTCGAGTTTGTCGCCGATGAGGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021979
VALIDATED
HSPA2 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-1708s1c1
Sequence:CCGGCCTGGAGTCCTATACCTACAACTCGAGTTGTAGGTATAGGACTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-1514s1c1
Sequence:CCGGACCTTCGACATTGACGCCAATCTCGAGATTGGCGTCAATGTCGAAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-655s1c1
Sequence:CCGGCGGCGAGAAGAACGTGCTCATCTCGAGATGAGCACGTTCTTCTCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-291s1c1
Sequence:CCGGAGAGGCTGATTGGACGGAAATCTCGAGATTTCCGTCCAATCAGCCTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-1217s1c1
Sequence:CCGGGCCATCCTCATCGGCGACAAACTCGAGTTTGTCGCCGATGAGGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021979
VALIDATED
HSPA2 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-1708s1c1
Sequence:CCGGCCTGGAGTCCTATACCTACAACTCGAGTTGTAGGTATAGGACTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-1514s1c1
Sequence:CCGGACCTTCGACATTGACGCCAATCTCGAGATTGGCGTCAATGTCGAAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-655s1c1
Sequence:CCGGCGGCGAGAAGAACGTGCTCATCTCGAGATGAGCACGTTCTTCTCGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-291s1c1
Sequence:CCGGAGAGGCTGATTGGACGGAAATCTCGAGATTTCCGTCCAATCAGCCTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021979.2-1217s1c1
Sequence:CCGGGCCATCCTCATCGGCGACAAACTCGAGTTTGTCGCCGATGAGGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008301
VALIDATED
HSPA2 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-2337s1c1
Sequence:CCGGGCTTGAAAGGAGAACCCTGATCTCGAGATCAGGGTTCTCCTTTCAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008301.2-1899s1c1
Sequence:CCGGGCAGAGAAAGATGAGTACGAACTCGAGTTCGTACTCATCTTTCTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-435s1c1
Sequence:CCGGCCCAAAGTGCAGGTGGAATATCTCGAGATATTCCACCTGCACTTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-1707s1c1
Sequence:CCGGGAGCGGTACAAATCGGAAGATCTCGAGATCTTCCGATTTGTACCGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-879s1c1
Sequence:CCGGCGCAAACACAAGAAGGACATTCTCGAGAATGTCCTTCTTGTGTTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008301.4-2171s21c1
Sequence:CCGGGTGCCAAGTAAGATCTATTATCTCGAGATAATAGATCTTACTTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008301.4-670s21c1
Sequence:CCGGACGTGTTGCGCATCATCAATGCTCGAGCATTGATGATGCGCAACACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008301.4-1825s21c1
Sequence:CCGGAGACCGTGGAAGACGAGAAACCTCGAGGTTTCTCGTCTTCCACGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008301
VALIDATED
HSPA2 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-2337s1c1
Sequence:CCGGGCTTGAAAGGAGAACCCTGATCTCGAGATCAGGGTTCTCCTTTCAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008301.2-1899s1c1
Sequence:CCGGGCAGAGAAAGATGAGTACGAACTCGAGTTCGTACTCATCTTTCTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-435s1c1
Sequence:CCGGCCCAAAGTGCAGGTGGAATATCTCGAGATATTCCACCTGCACTTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-1707s1c1
Sequence:CCGGGAGCGGTACAAATCGGAAGATCTCGAGATCTTCCGATTTGTACCGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-879s1c1
Sequence:CCGGCGCAAACACAAGAAGGACATTCTCGAGAATGTCCTTCTTGTGTTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008301.4-2171s21c1
Sequence:CCGGGTGCCAAGTAAGATCTATTATCTCGAGATAATAGATCTTACTTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008301.4-670s21c1
Sequence:CCGGACGTGTTGCGCATCATCAATGCTCGAGCATTGATGATGCGCAACACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008301.4-1825s21c1
Sequence:CCGGAGACCGTGGAAGACGAGAAACCTCGAGGTTTCTCGTCTTCCACGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008301
VALIDATED
HSPA2 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-2337s1c1
Sequence:CCGGGCTTGAAAGGAGAACCCTGATCTCGAGATCAGGGTTCTCCTTTCAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008301.2-1899s1c1
Sequence:CCGGGCAGAGAAAGATGAGTACGAACTCGAGTTCGTACTCATCTTTCTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-435s1c1
Sequence:CCGGCCCAAAGTGCAGGTGGAATATCTCGAGATATTCCACCTGCACTTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-1707s1c1
Sequence:CCGGGAGCGGTACAAATCGGAAGATCTCGAGATCTTCCGATTTGTACCGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008301.2-879s1c1
Sequence:CCGGCGCAAACACAAGAAGGACATTCTCGAGAATGTCCTTCTTGTGTTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008301.4-2171s21c1
Sequence:CCGGGTGCCAAGTAAGATCTATTATCTCGAGATAATAGATCTTACTTGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008301.4-670s21c1
Sequence:CCGGACGTGTTGCGCATCATCAATGCTCGAGCATTGATGATGCGCAACACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008301.4-1825s21c1
Sequence:CCGGAGACCGTGGAAGACGAGAAACCTCGAGGTTTCTCGTCTTCCACGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)