EMAIL THIS PAGE TO A FRIEND

HSPA4

heat shock 70kDa protein 4

116 Gene Product Result for
Synonyms: APG-2 HS24/P52 HSPH2 RY hsp70 hsp70RY
UniProtKB ID: P34932, O95756, Q2TAL4
Gene ID:
Mouse(15525) heat shock protein 4
Rat(266759) heat shock protein 4
sheep(101122782) heat shock 70kDa protein 4
domestic guinea pig(100735343) heat shock 70kDa protein 4
naked mole-rat(101710260) heat shock 70kDa protein 4
chicken(416339) heat shock 70kDa protein 4
cow(281828) heat shock 70kDa protein 4
Horse(100072809) heat shock 70kDa protein 4
cow(536558) heat shock 70kDa protein 4
domestic cat(101097784) heat shock 70kDa protein 4
dog(474680) heat shock 70kDa protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002154 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002154 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002154 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008300 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008300 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008300 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002154 Rosetta Predictions human pricing
NM_198431 Rosetta Predictions human pricing
NM_153629 Rosetta Predictions rat pricing
NM_008300 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333343 predicted 1351
2 SASI_Hs02_00333344 predicted 2540
3 SASI_Hs02_00333345 predicted 626
4 SASI_Hs02_00333346 predicted 1630
5 SASI_Hs02_00333347 predicted 2437
6 SASI_Hs02_00333348 predicted 2601
7 SASI_Hs02_00333349 predicted 895
8 SASI_Hs02_00333350 predicted 1712
9 SASI_Hs02_00333351 predicted 1288
10 SASI_Hs02_00333352 predicted 683
11 SASI_Hs01_00020701 predicted 351
12 SASI_Hs01_00020702 predicted 354
13 SASI_Hs01_00020703 predicted 2897
14 SASI_Hs01_00020704 predicted 3064
15 SASI_Hs01_00020705 predicted 3024
16 SASI_Hs01_00020706 predicted 3028
17 SASI_Hs01_00020707 predicted 3046
18 SASI_Hs01_00020708 predicted 3117
19 SASI_Hs01_00020709 predicted 3105
20 SASI_Hs01_00020710 predicted 3033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087928 predicted 342
2 SASI_Hs01_00087929 predicted 358
3 SASI_Hs01_00087930 predicted 820
4 SASI_Hs01_00087931 predicted 980
5 SASI_Hs01_00087932 predicted 950
6 SASI_Hs01_00087933 predicted 959
7 SASI_Hs01_00087934 predicted 976
8 SASI_Hs01_00087935 predicted 1042
9 SASI_Hs01_00087936 predicted 1030
10 SASI_Hs01_00087937 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058690 predicted 2243
2 SASI_Rn01_00058691 predicted 2254
3 SASI_Rn01_00058692 predicted 711
4 SASI_Rn02_00269002 predicted 2008
5 SASI_Rn01_00058694 predicted 2827
6 SASI_Rn01_00058695 predicted 703
7 SASI_Rn01_00058696 predicted 405
8 SASI_Rn02_00269003 predicted 763
9 SASI_Rn01_00058697 predicted 370
10 SASI_Rn01_00058699 predicted 1041
11 SASI_Rn01_00058693 predicted 2842
12 SASI_Rn01_00058698 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313588 predicted 1386
2 SASI_Mm01_00156794 predicted 2106
3 SASI_Mm02_00313589 predicted 2914
4 SASI_Mm01_00156795 predicted 1967
5 SASI_Mm01_00156796 predicted 2644
6 SASI_Mm01_00156797 predicted 652
7 SASI_Mm02_00313590 predicted 2930
8 SASI_Mm01_00156798 predicted 799
9 SASI_Mm01_00156799 predicted 1202
10 SASI_Mm01_00156801 predicted 1325
11 SASI_Mm01_00156800 predicted 405
12 SASI_Mm01_00156802 predicted 1078
13 SASI_Mm01_00156803 predicted 1421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002154
VALIDATED
HSPA4 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002154.3-3160s21c1
Sequence:CCGGACATGGCAGGAGCTCTAATTACTCGAGTAATTAGAGCTCCTGCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002154.3-497s21c1
Sequence:CCGGCCGAGCATTCTCTGATCCATTCTCGAGAATGGATCAGAGAATGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002154.3-2849s21c1
Sequence:CCGGAGTTGTCAACTTTGTTCTAAACTCGAGTTTAGAACAAAGTTGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002154.3-2019s21c1
Sequence:CCGGCCAATCGAGAATCAGCTATTACTCGAGTAATAGCTGATTCTCGATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002154.3-2759s21c1
Sequence:CCGGGCCTTCGGATTCAGACAAGAACTCGAGTTCTTGTCTGAATCCGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-952s1c1
Sequence:CCGGCCACTGCATTTGACACGACATCTCGAGATGTCGTGTCAAATGCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-497s1c1
Sequence:CCGGCCGAGCATTCTCTGATCCATTCTCGAGAATGGATCAGAGAATGCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002154.3-3030s1c1
Sequence:CCGGCCAGTTAGTCTTACTGAGCTTCTCGAGAAGCTCAGTAAGACTAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-2759s1c1
Sequence:CCGGGCCTTCGGATTCAGACAAGAACTCGAGTTCTTGTCTGAATCCGAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-2019s1c1
Sequence:CCGGCCAATCGAGAATCAGCTATTACTCGAGTAATAGCTGATTCTCGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002154
VALIDATED
HSPA4 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002154.3-3160s21c1
Sequence:CCGGACATGGCAGGAGCTCTAATTACTCGAGTAATTAGAGCTCCTGCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002154.3-497s21c1
Sequence:CCGGCCGAGCATTCTCTGATCCATTCTCGAGAATGGATCAGAGAATGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002154.3-2849s21c1
Sequence:CCGGAGTTGTCAACTTTGTTCTAAACTCGAGTTTAGAACAAAGTTGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002154.3-2019s21c1
Sequence:CCGGCCAATCGAGAATCAGCTATTACTCGAGTAATAGCTGATTCTCGATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002154.3-2759s21c1
Sequence:CCGGGCCTTCGGATTCAGACAAGAACTCGAGTTCTTGTCTGAATCCGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-952s1c1
Sequence:CCGGCCACTGCATTTGACACGACATCTCGAGATGTCGTGTCAAATGCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-497s1c1
Sequence:CCGGCCGAGCATTCTCTGATCCATTCTCGAGAATGGATCAGAGAATGCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002154.3-3030s1c1
Sequence:CCGGCCAGTTAGTCTTACTGAGCTTCTCGAGAAGCTCAGTAAGACTAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-2759s1c1
Sequence:CCGGGCCTTCGGATTCAGACAAGAACTCGAGTTCTTGTCTGAATCCGAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-2019s1c1
Sequence:CCGGCCAATCGAGAATCAGCTATTACTCGAGTAATAGCTGATTCTCGATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002154
VALIDATED
HSPA4 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369037    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002154.3-3160s21c1
Sequence:CCGGACATGGCAGGAGCTCTAATTACTCGAGTAATTAGAGCTCCTGCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002154.3-497s21c1
Sequence:CCGGCCGAGCATTCTCTGATCCATTCTCGAGAATGGATCAGAGAATGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002154.3-2849s21c1
Sequence:CCGGAGTTGTCAACTTTGTTCTAAACTCGAGTTTAGAACAAAGTTGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002154.3-2019s21c1
Sequence:CCGGCCAATCGAGAATCAGCTATTACTCGAGTAATAGCTGATTCTCGATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_002154.3-2759s21c1
Sequence:CCGGGCCTTCGGATTCAGACAAGAACTCGAGTTCTTGTCTGAATCCGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-952s1c1
Sequence:CCGGCCACTGCATTTGACACGACATCTCGAGATGTCGTGTCAAATGCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-497s1c1
Sequence:CCGGCCGAGCATTCTCTGATCCATTCTCGAGAATGGATCAGAGAATGCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002154.3-3030s1c1
Sequence:CCGGCCAGTTAGTCTTACTGAGCTTCTCGAGAAGCTCAGTAAGACTAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-2759s1c1
Sequence:CCGGGCCTTCGGATTCAGACAAGAACTCGAGTTCTTGTCTGAATCCGAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002154.3-2019s1c1
Sequence:CCGGCCAATCGAGAATCAGCTATTACTCGAGTAATAGCTGATTCTCGATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008300
VALIDATED
HSPA4 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008300.3-2239s1c1
Sequence:CCGGGAGTGAAGATGATCGTAATACCTCGAGGTATTACGATCATCTTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-383s1c1
Sequence:CCGGGCCAGGTAATTTCTAATGCCACTCGAGTGGCATTAGAAATTACCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-518s1c1
Sequence:CCGGCGGGCATAAAGGTTACATATACTCGAGTATATGTAACCTTTATGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-754s1c1
Sequence:CCGGGCTCTTGCTTATGGAATCTATCTCGAGATAGATTCCATAAGCAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-2016s1c1
Sequence:CCGGCACAGAGAATGAGGGTAAGATCTCGAGATCTTACCCTCATTCTCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008300.2-1418s1c1
Sequence:CCGGCATATCCAATATCTTTGCGATCTCGAGATCGCAAAGATATTGGATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008300.2-506s1c1
Sequence:CCGGCCACTGGATTAACGGGCATAACTCGAGTTATGCCCGTTAATCCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008300.2-2550s1c1
Sequence:CCGGGACAAGTATTTGCAGTCCTATCTCGAGATAGGACTGCAAATACTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008300
VALIDATED
HSPA4 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008300.3-2239s1c1
Sequence:CCGGGAGTGAAGATGATCGTAATACCTCGAGGTATTACGATCATCTTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-383s1c1
Sequence:CCGGGCCAGGTAATTTCTAATGCCACTCGAGTGGCATTAGAAATTACCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-518s1c1
Sequence:CCGGCGGGCATAAAGGTTACATATACTCGAGTATATGTAACCTTTATGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-754s1c1
Sequence:CCGGGCTCTTGCTTATGGAATCTATCTCGAGATAGATTCCATAAGCAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-2016s1c1
Sequence:CCGGCACAGAGAATGAGGGTAAGATCTCGAGATCTTACCCTCATTCTCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008300.2-1418s1c1
Sequence:CCGGCATATCCAATATCTTTGCGATCTCGAGATCGCAAAGATATTGGATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008300.2-506s1c1
Sequence:CCGGCCACTGGATTAACGGGCATAACTCGAGTTATGCCCGTTAATCCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008300.2-2550s1c1
Sequence:CCGGGACAAGTATTTGCAGTCCTATCTCGAGATAGGACTGCAAATACTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008300
VALIDATED
HSPA4 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008300.3-2239s1c1
Sequence:CCGGGAGTGAAGATGATCGTAATACCTCGAGGTATTACGATCATCTTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-383s1c1
Sequence:CCGGGCCAGGTAATTTCTAATGCCACTCGAGTGGCATTAGAAATTACCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-518s1c1
Sequence:CCGGCGGGCATAAAGGTTACATATACTCGAGTATATGTAACCTTTATGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-754s1c1
Sequence:CCGGGCTCTTGCTTATGGAATCTATCTCGAGATAGATTCCATAAGCAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008300.2-2016s1c1
Sequence:CCGGCACAGAGAATGAGGGTAAGATCTCGAGATCTTACCCTCATTCTCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008300.2-1418s1c1
Sequence:CCGGCATATCCAATATCTTTGCGATCTCGAGATCGCAAAGATATTGGATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200019    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008300.2-506s1c1
Sequence:CCGGCCACTGGATTAACGGGCATAACTCGAGTTATGCCCGTTAATCCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008300.2-2550s1c1
Sequence:CCGGGACAAGTATTTGCAGTCCTATCTCGAGATAGGACTGCAAATACTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)