EMAIL THIS PAGE TO A FRIEND

HSPA4L

heat shock 70kDa protein 4-like

93 Gene Product Result for
Synonyms: APG-1 HSPH3 Osp94
UniProtKB ID: O95757, A2ICT2, Q4W5M5, Q8IWA2
Gene ID:
Mouse(18415) heat shock protein 4 like
Rat(294993) heat shock protein 4-like
chicken(422496) heat shock 70kDa protein 4-like
domestic cat(101086545) heat shock 70kDa protein 4-like
cow(506096) heat shock 70kDa protein 4-like
dog(476089) heat shock 70kDa protein 4-like
domestic guinea pig(100723123) heat shock 70kDa protein 4-like
naked mole-rat(101699137) heat shock 70kDa protein 4-like
sheep(101122219) heat shock 70kDa protein 4-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014278 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011020 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011020 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011020 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014278 Rosetta Predictions human pricing
NM_001106428 Rosetta Predictions rat pricing
NM_011020 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345351 predicted 2396
2 SASI_Hs01_00014244 predicted 605
3 SASI_Hs01_00014245 predicted 859
4 SASI_Hs02_00345352 predicted 2418
5 SASI_Hs01_00014247 predicted 2234
6 SASI_Hs02_00345353 predicted 601
7 SASI_Hs01_00014248 predicted 1931
8 SASI_Hs01_00014249 predicted 422
9 SASI_Hs01_00014250 predicted 740
10 SASI_Hs01_00014251 predicted 410
11 SASI_Hs01_00014243 predicted 1289
12 SASI_Hs01_00014246 predicted 906
13 SASI_Hs01_00014252 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106428 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218868 predicted 1238
2 SASI_Rn02_00218869 predicted 2266
3 SASI_Rn02_00218870 predicted 828
4 SASI_Rn02_00218871 predicted 686
5 SASI_Rn02_00218872 predicted 872
6 SASI_Rn02_00218873 predicted 2861
7 SASI_Rn02_00218874 predicted 1474
8 SASI_Rn02_00218875 predicted 3156
9 SASI_Rn02_00218876 predicted 2274
10 SASI_Rn02_00218877 predicted 1735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011020 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108912 predicted 2228
2 SASI_Mm01_00108913 predicted 1950
3 SASI_Mm02_00319746 predicted 1607
4 SASI_Mm01_00108914 predicted 418
5 SASI_Mm01_00108915 predicted 1348
6 SASI_Mm01_00108916 predicted 357
7 SASI_Mm01_00108917 predicted 2383
8 SASI_Mm01_00108918 predicted 2287
9 SASI_Mm01_00108920 predicted 1027
10 SASI_Mm02_00319747 predicted 957
11 SASI_Mm01_00108919 predicted 1766
12 SASI_Mm01_00108921 predicted 1366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014278
VALIDATED
HSPA4L MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 4-like
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-1034s1c1
Sequence:CCGGCGGGCCTTGTTGCGTTTATATCTCGAGATATAAACGCAACAAGGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014278.2-2958s1c1
Sequence:CCGGGCAGTGTTAGCCGAATTAGATCTCGAGATCTAATTCGGCTAACACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014278.2-2308s1c1
Sequence:CCGGCCAGCCTATTCAAATGAAGTACTCGAGTACTTCATTTGAATAGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014278.2-923s1c1
Sequence:CCGGGCTACTACCTTTGATCCATATCTCGAGATATGGATCAAAGGTAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014278.2-3119s1c1
Sequence:CCGGGCATTATTGTTGCAGAAGCATCTCGAGATGCTTCTGCAACAATAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-2926s1c1
Sequence:CCGGGCACTTCTGTTCATTTCCATTCTCGAGAATGGAAATGAACAGAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014278.2-470s1c1
Sequence:CCGGCGATCATTTGATGATCCCATTCTCGAGAATGGGATCATCAAATGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-1938s1c1
Sequence:CCGGCAGACAAACAAGACCGATTAACTCGAGTTAATCGGTCTTGTTTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-2111s1c1
Sequence:CCGGGCTAAGAATGCCGTTGAAGAACTCGAGTTCTTCAACGGCATTCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014278.2-2737s1c1
Sequence:CCGGGCATACTAAATCCTCTGGAGACTCGAGTCTCCAGAGGATTTAGTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-2278s21c1
Sequence:CCGGGGATAAGCTTCAAGAACTAAACTCGAGTTTAGTTCTTGAAGCTTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-2073s21c1
Sequence:CCGGTGATCATGCAAGATAAGTTAGCTCGAGCTAACTTATCTTGCATGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-1687s21c1
Sequence:CCGGGAAGGTTAAAGTTCGTGTTAACTCGAGTTAACACGAACTTTAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-1409s21c1
Sequence:CCGGGCATTTAAAGTGCGTGAATTTCTCGAGAAATTCACGCACTTTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014278
VALIDATED
HSPA4L MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 4-like
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-1034s1c1
Sequence:CCGGCGGGCCTTGTTGCGTTTATATCTCGAGATATAAACGCAACAAGGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014278.2-2958s1c1
Sequence:CCGGGCAGTGTTAGCCGAATTAGATCTCGAGATCTAATTCGGCTAACACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014278.2-2308s1c1
Sequence:CCGGCCAGCCTATTCAAATGAAGTACTCGAGTACTTCATTTGAATAGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014278.2-923s1c1
Sequence:CCGGGCTACTACCTTTGATCCATATCTCGAGATATGGATCAAAGGTAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014278.2-3119s1c1
Sequence:CCGGGCATTATTGTTGCAGAAGCATCTCGAGATGCTTCTGCAACAATAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-2926s1c1
Sequence:CCGGGCACTTCTGTTCATTTCCATTCTCGAGAATGGAAATGAACAGAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014278.2-470s1c1
Sequence:CCGGCGATCATTTGATGATCCCATTCTCGAGAATGGGATCATCAAATGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-1938s1c1
Sequence:CCGGCAGACAAACAAGACCGATTAACTCGAGTTAATCGGTCTTGTTTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-2111s1c1
Sequence:CCGGGCTAAGAATGCCGTTGAAGAACTCGAGTTCTTCAACGGCATTCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014278.2-2737s1c1
Sequence:CCGGGCATACTAAATCCTCTGGAGACTCGAGTCTCCAGAGGATTTAGTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-2278s21c1
Sequence:CCGGGGATAAGCTTCAAGAACTAAACTCGAGTTTAGTTCTTGAAGCTTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-2073s21c1
Sequence:CCGGTGATCATGCAAGATAAGTTAGCTCGAGCTAACTTATCTTGCATGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-1687s21c1
Sequence:CCGGGAAGGTTAAAGTTCGTGTTAACTCGAGTTAACACGAACTTTAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-1409s21c1
Sequence:CCGGGCATTTAAAGTGCGTGAATTTCTCGAGAAATTCACGCACTTTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014278
VALIDATED
HSPA4L MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 4-like
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-1034s1c1
Sequence:CCGGCGGGCCTTGTTGCGTTTATATCTCGAGATATAAACGCAACAAGGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014278.2-2958s1c1
Sequence:CCGGGCAGTGTTAGCCGAATTAGATCTCGAGATCTAATTCGGCTAACACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151719    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014278.2-2308s1c1
Sequence:CCGGCCAGCCTATTCAAATGAAGTACTCGAGTACTTCATTTGAATAGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_014278.2-923s1c1
Sequence:CCGGGCTACTACCTTTGATCCATATCTCGAGATATGGATCAAAGGTAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014278.2-3119s1c1
Sequence:CCGGGCATTATTGTTGCAGAAGCATCTCGAGATGCTTCTGCAACAATAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150919    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-2926s1c1
Sequence:CCGGGCACTTCTGTTCATTTCCATTCTCGAGAATGGAAATGAACAGAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151695    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014278.2-470s1c1
Sequence:CCGGCGATCATTTGATGATCCCATTCTCGAGAATGGGATCATCAAATGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-1938s1c1
Sequence:CCGGCAGACAAACAAGACCGATTAACTCGAGTTAATCGGTCTTGTTTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014278.2-2111s1c1
Sequence:CCGGGCTAAGAATGCCGTTGAAGAACTCGAGTTCTTCAACGGCATTCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014278.2-2737s1c1
Sequence:CCGGGCATACTAAATCCTCTGGAGACTCGAGTCTCCAGAGGATTTAGTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-2278s21c1
Sequence:CCGGGGATAAGCTTCAAGAACTAAACTCGAGTTTAGTTCTTGAAGCTTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-2073s21c1
Sequence:CCGGTGATCATGCAAGATAAGTTAGCTCGAGCTAACTTATCTTGCATGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-1687s21c1
Sequence:CCGGGAAGGTTAAAGTTCGTGTTAACTCGAGTTAACACGAACTTTAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014278.2-1409s21c1
Sequence:CCGGGCATTTAAAGTGCGTGAATTTCTCGAGAAATTCACGCACTTTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011020
VALIDATED
HSPA4L MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 4-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011020.3-3321s1c1
Sequence:CCGGCCGACAGACTTGGTTCAGTTTCTCGAGAAACTGAACCAAGTCTGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011020.3-1009s1c1
Sequence:CCGGCCAGGGTTGAACCACCTTTAACTCGAGTTAAAGGTGGTTCAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011020.3-1035s1c1
Sequence:CCGGGTAATGGATCAAGCTAACTTACTCGAGTAAGTTAGCTTGATCCATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011020.3-631s1c1
Sequence:CCGGCCTCATTAGATGAGAAACCAACTCGAGTTGGTTTCTCATCTAATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011020.3-2415s1c1
Sequence:CCGGCCCATCGTTTATAAGCCCAAACTCGAGTTTGGGCTTATAAACGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-271s21c1
Sequence:CCGGAGCTTCATGGGCGATCATTTGCTCGAGCAAATGATCGCCCATGAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-1752s21c1
Sequence:CCGGGATAAGCAAGATCGCATAAATCTCGAGATTTATGCGATCTTGCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-737s21c1
Sequence:CCGGTACTACCTTTGACCCATATTTCTCGAGAAATATGGGTCAAAGGTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-1221s21c1
Sequence:CCGGGCATTTAAAGTACGTGAATTTCTCGAGAAATTCACGTACTTTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011020
VALIDATED
HSPA4L MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 4-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011020.3-3321s1c1
Sequence:CCGGCCGACAGACTTGGTTCAGTTTCTCGAGAAACTGAACCAAGTCTGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011020.3-1009s1c1
Sequence:CCGGCCAGGGTTGAACCACCTTTAACTCGAGTTAAAGGTGGTTCAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011020.3-1035s1c1
Sequence:CCGGGTAATGGATCAAGCTAACTTACTCGAGTAAGTTAGCTTGATCCATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011020.3-631s1c1
Sequence:CCGGCCTCATTAGATGAGAAACCAACTCGAGTTGGTTTCTCATCTAATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011020.3-2415s1c1
Sequence:CCGGCCCATCGTTTATAAGCCCAAACTCGAGTTTGGGCTTATAAACGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-271s21c1
Sequence:CCGGAGCTTCATGGGCGATCATTTGCTCGAGCAAATGATCGCCCATGAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-1752s21c1
Sequence:CCGGGATAAGCAAGATCGCATAAATCTCGAGATTTATGCGATCTTGCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-737s21c1
Sequence:CCGGTACTACCTTTGACCCATATTTCTCGAGAAATATGGGTCAAAGGTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-1221s21c1
Sequence:CCGGGCATTTAAAGTACGTGAATTTCTCGAGAAATTCACGTACTTTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011020
VALIDATED
HSPA4L MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 4-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011020.3-3321s1c1
Sequence:CCGGCCGACAGACTTGGTTCAGTTTCTCGAGAAACTGAACCAAGTCTGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011020.3-1009s1c1
Sequence:CCGGCCAGGGTTGAACCACCTTTAACTCGAGTTAAAGGTGGTTCAACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011020.3-1035s1c1
Sequence:CCGGGTAATGGATCAAGCTAACTTACTCGAGTAAGTTAGCTTGATCCATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011020.3-631s1c1
Sequence:CCGGCCTCATTAGATGAGAAACCAACTCGAGTTGGTTTCTCATCTAATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011020.3-2415s1c1
Sequence:CCGGCCCATCGTTTATAAGCCCAAACTCGAGTTTGGGCTTATAAACGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-271s21c1
Sequence:CCGGAGCTTCATGGGCGATCATTTGCTCGAGCAAATGATCGCCCATGAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-1752s21c1
Sequence:CCGGGATAAGCAAGATCGCATAAATCTCGAGATTTATGCGATCTTGCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-737s21c1
Sequence:CCGGTACTACCTTTGACCCATATTTCTCGAGAAATATGGGTCAAAGGTAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011020.3-1221s21c1
Sequence:CCGGGCATTTAAAGTACGTGAATTTCTCGAGAAATTCACGTACTTTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)