EMAIL THIS PAGE TO A FRIEND

HSPA5

heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)

120 Gene Product Result for
Synonyms: BIP GRP78 MIF2
UniProtKB ID: P11021, B0QZ61, Q2EF78, Q9NPF1, Q9UK02
Gene ID:
Human(3309) Summary: The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010]
Mouse(14828) heat shock protein 5
Rat(25617) heat shock protein 5
sheep(780447) heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
domestic guinea pig(100731108) heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
naked mole-rat(101713339) heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
Zebrafish(378848) heat shock protein 5
chicken(396487) heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
domestic cat(101083630) heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
cow(415113) heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
dog(480726) heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501452 Anti-GRP78 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
G9043 Anti-GRP78/BiP (ET-21) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution Xenopus, hamster, chicken, rat, mouse, human
immunocytochemistry, western blot pricing
G8918 Anti-GRP78/BiP (GL-19) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, hamster
immunocytochemistry, microarray, western blot pricing
HPA038845 Anti-HSPA5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA038846 Anti-HSPA5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunohistochemistry, western blot pricing
SAB5200177 Monoclonal Anti-Grp78 - Alkaline Phosphatase antibody produced in mouse clone 3C5-1A4, purified immunoglobulin mouse, rat, human
ELISA, western blot pricing
SAB5200195 Monoclonal Anti-Grp78 - Alkaline Phosphatase antibody produced in mouse clone 3G12-1G11, purified immunoglobulin rat, human, mouse
ELISA, western blot pricing
SAB5200178 Monoclonal Anti-Grp78 - Apc antibody produced in mouse clone 3C5-1A4, purified immunoglobulin rat, mouse, human
ELISA, western blot pricing
SAB5200196 Monoclonal Anti-Grp78 - Apc antibody produced in mouse clone 3G12-1G11, purified immunoglobulin rat, mouse, human
ELISA, western blot pricing
SAB5200169 Monoclonal Anti-Grp78 - Atto 390 antibody produced in mouse clone 3C5-1A4, purified immunoglobulin rat, human, mouse
ELISA, western blot pricing
SAB5200187 Monoclonal Anti-Grp78 - Atto 390 antibody produced in mouse clone 3G12-1G11, purified immunoglobulin mouse, human, rat
ELISA, western blot pricing
SAB5200170 Monoclonal Anti-Grp78 - Atto 488 antibody produced in mouse clone 3C5-1A4, purified immunoglobulin mouse, rat, human
ELISA, western blot pricing
SAB5200188 Monoclonal Anti-Grp78 - Atto 488 antibody produced in mouse clone 3G12-1G11, purified immunoglobulin mouse, rat, human
ELISA, western blot pricing
SAB5200171 Monoclonal Anti-Grp78 - Atto 565 antibody produced in mouse clone 3C5-1A4, purified immunoglobulin human, mouse, rat
ELISA, western blot pricing
SAB5200189 Monoclonal Anti-Grp78 - Atto 565 antibody produced in mouse clone 3G12-1G11, purified immunoglobulin mouse, human, rat
ELISA, western blot pricing
SAB5200172 Monoclonal Anti-Grp78 - Atto 594 antibody produced in mouse clone 3C5-1A4, purified immunoglobulin human, mouse, rat
ELISA, western blot pricing
SAB5200190 Monoclonal Anti-Grp78 - Atto 594 antibody produced in mouse clone 3G12-1G11, purified immunoglobulin mouse, human, rat
ELISA, western blot pricing
SAB5200173 Monoclonal Anti-Grp78 - Atto 633 antibody produced in mouse clone 3C5-1A4, purified immunoglobulin rat, human, mouse
ELISA, western blot pricing
SAB5200191 Monoclonal Anti-Grp78 - Atto 633 antibody produced in mouse clone 3G12-1G11, purified immunoglobulin human, rat, mouse
ELISA, western blot pricing
SAB5200174 Monoclonal Anti-Grp78 - Atto 655 antibody produced in mouse clone 3C5-1A4, purified immunoglobulin mouse, rat, human
ELISA, western blot pricing
SAB5200192 Monoclonal Anti-Grp78 - Atto 655 antibody produced in mouse clone 3G12-1G11, purified immunoglobulin human, mouse, rat
ELISA, western blot pricing
SAB5200175 Monoclonal Anti-Grp78 - Atto 680 antibody produced in mouse clone 3C5-1A4, purified immunoglobulin rat, human, mouse
ELISA, western blot pricing
SAB5200193 Monoclonal Anti-Grp78 - Atto 680 antibody produced in mouse clone 3G12-1G11, purified immunoglobulin human, mouse, rat
ELISA, western blot pricing
SAB5200176 Monoclonal Anti-Grp78 - Atto 700 antibody produced in mouse clone 3C5-1A4, purified immunoglobulin mouse, human, rat
ELISA, western blot pricing
SAB5200194 Monoclonal Anti-Grp78 - Atto 700 antibody produced in mouse clone 3G12-1G11, purified immunoglobulin human, mouse, rat
ELISA, western blot pricing
SAB5200179 Monoclonal Anti-Grp78 - Biotin antibody produced in mouse clone 3C5-1A4, purified immunoglobulin human, mouse, rat
ELISA, western blot pricing
SAB5200197 Monoclonal Anti-Grp78 - Biotin antibody produced in mouse clone 3G12-1G11, purified immunoglobulin mouse, rat, human
ELISA, western blot pricing
SAB5200180 Monoclonal Anti-Grp78 - Fitc antibody produced in mouse clone 3C5-1A4, purified immunoglobulin human, rat, mouse
ELISA, western blot pricing
SAB5200198 Monoclonal Anti-Grp78 - Fitc antibody produced in mouse clone 3G12-1G11, purified immunoglobulin human, rat, mouse
ELISA, western blot pricing
SAB5200181 Monoclonal Anti-Grp78 - Hrp antibody produced in mouse clone 3C5-1A4, purified immunoglobulin rat, mouse, human
ELISA, western blot pricing
SAB5200199 Monoclonal Anti-Grp78 - Hrp antibody produced in mouse clone 3G12-1G11, purified immunoglobulin mouse, human, rat
ELISA, western blot pricing
SAB5200182 Monoclonal Anti-Grp78 - PE/Atto 594 antibody produced in mouse clone 3C5-1A4, purified immunoglobulin mouse, human, rat
ELISA, western blot pricing
SAB5200200 Monoclonal Anti-Grp78 - PE/Atto 594 antibody produced in mouse clone 3G12-1G11, purified immunoglobulin mouse, rat, human
ELISA, western blot pricing
SAB5200183 Monoclonal Anti-Grp78 - PerCP antibody produced in mouse clone 3C5-1A4, purified immunoglobulin mouse, human, rat
ELISA, western blot pricing
SAB5200201 Monoclonal Anti-Grp78 - PerCP antibody produced in mouse clone 3G12-1G11, purified immunoglobulin rat, mouse, human
ELISA, western blot pricing
SAB5200184 Monoclonal Anti-Grp78 - RPE antibody produced in mouse clone 3C5-1A4, purified immunoglobulin mouse, human, rat
ELISA, western blot pricing
SAB5200202 Monoclonal Anti-Grp78 - RPE antibody produced in mouse clone 3G12-1G11, purified immunoglobulin rat, human, mouse
ELISA, western blot pricing
SAB5200185 Monoclonal Anti-Grp78 - Streptavidin antibody produced in mouse clone 3C5-1A4, purified immunoglobulin human, rat, mouse
ELISA, western blot pricing
SAB5200203 Monoclonal Anti-Grp78 - Streptavidin antibody produced in mouse clone 3G12-1G11, purified immunoglobulin mouse, rat, human
ELISA, western blot pricing
SAB5200168 Monoclonal Anti-Grp78 antibody produced in mouse clone 3C5-1A4, purified immunoglobulin human, mouse, rat
ELISA, western blot pricing
SAB5200186 Monoclonal Anti-Grp78 antibody produced in mouse clone 3G12-1G11, purified immunoglobulin mouse, human, rat
ELISA, western blot pricing
SAB5300084 Monoclonal Anti-HSPA5 antibody produced in mouse clone 4E3, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0806 AQUA Peptide ITPSYVAFTPEGE[R] human, mouse, rat pricing
AQ0805 AQUA Peptide VEIIANDQGN[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005347 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005347 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005347 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005347 Rosetta Predictions human pricing
NM_013083 Rosetta Predictions rat pricing
NM_022310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142880 predicted 1562
2 SASI_Hs02_00339425 predicted 1579
3 SASI_Hs01_00142882 predicted 705
4 SASI_Hs02_00339426 predicted 1621
5 SASI_Hs01_00142883 predicted 526
6 SASI_Hs01_00142885 predicted 1703
7 SASI_Hs01_00142887 predicted 934
8 SASI_Hs01_00142888 predicted 1532
9 SASI_Hs02_00339427 predicted 1137
10 SASI_Hs02_00339428 predicted 1682
11 SASI_Hs01_00142881 predicted 773
12 SASI_Hs01_00142884 predicted 1325
13 SASI_Hs01_00142886 predicted 1119
14 SASI_Hs01_00142889 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056633 predicted 954
2 SASI_Rn01_00056634 predicted 1387
3 SASI_Rn01_00056635 predicted 1474
4 SASI_Rn01_00056636 predicted 1415
5 SASI_Rn01_00056637 predicted 972
6 SASI_Rn01_00056638 predicted 518
7 SASI_Rn01_00056639 predicted 790
8 SASI_Rn01_00056640 predicted 1551
9 SASI_Rn01_00056641 predicted 1919
10 SASI_Rn01_00056642 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169655 predicted 1727
2 SASI_Mm01_00169656 predicted 1450
3 SASI_Mm01_00169657 predicted 1912
4 SASI_Mm01_00169658 predicted 785
5 SASI_Mm01_00169659 predicted 1561
6 SASI_Mm01_00169660 predicted 1146
7 SASI_Mm01_00169661 predicted 1650
8 SASI_Mm01_00169662 predicted 1133
9 SASI_Mm01_00169663 predicted 962
10 SASI_Mm01_00169664 predicted 1832
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022310
HSPA5 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-697s21c1
Sequence:CCGGGGAGACTGCTGAGGCGTATTTCTCGAGAAATACGCCTCAGCAGTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-1586s21c1
Sequence:CCGGTTCTCCACGGCTTCCGATAATCTCGAGATTATCGGAAGCCGTGGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-2066s21c1
Sequence:CCGGGCGGACATTGAAGACTTTAAACTCGAGTTTAAAGTCTTCAATGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-1195s21c1
Sequence:CCGGGACCCTTACTCGGGCCAAATTCTCGAGAATTTGGCCCGAGTAAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-1844s21c1
Sequence:CCGGGAAATTGAAAGGATGGTTAATCTCGAGATTAACCATCCTTTCAATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022310.3-2391s21c1
Sequence:CCGGGAGAGGAGGAATTGGCTATTTCTCGAGAAATAGCCAATTCCTCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-1611s1c1
Sequence:CCGGGTAACAATCAAGGTCTATGAACTCGAGTTCATAGACCTTGATTGTTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-1492s1c1
Sequence:CCGGCCCTTACACTTGGTATTGAAACTCGAGTTTCAATACCAAGTGTAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-606s1c1
Sequence:CCGGCCGTACATTCAAGTTGATATTCTCGAGAATATCAACTTGAATGTACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022310.2-2278s1c1
Sequence:CCGGCTCGAATGTAATTGGAATCTTCTCGAGAAGATTCCAATTACATTCGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-2114s1c1
Sequence:CCGGGCCAATTATCAGCAAACTCTACTCGAGTAGAGTTTGCTGATAATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022310
HSPA5 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-697s21c1
Sequence:CCGGGGAGACTGCTGAGGCGTATTTCTCGAGAAATACGCCTCAGCAGTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-1586s21c1
Sequence:CCGGTTCTCCACGGCTTCCGATAATCTCGAGATTATCGGAAGCCGTGGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-2066s21c1
Sequence:CCGGGCGGACATTGAAGACTTTAAACTCGAGTTTAAAGTCTTCAATGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-1195s21c1
Sequence:CCGGGACCCTTACTCGGGCCAAATTCTCGAGAATTTGGCCCGAGTAAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-1844s21c1
Sequence:CCGGGAAATTGAAAGGATGGTTAATCTCGAGATTAACCATCCTTTCAATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022310.3-2391s21c1
Sequence:CCGGGAGAGGAGGAATTGGCTATTTCTCGAGAAATAGCCAATTCCTCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-1611s1c1
Sequence:CCGGGTAACAATCAAGGTCTATGAACTCGAGTTCATAGACCTTGATTGTTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-1492s1c1
Sequence:CCGGCCCTTACACTTGGTATTGAAACTCGAGTTTCAATACCAAGTGTAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-606s1c1
Sequence:CCGGCCGTACATTCAAGTTGATATTCTCGAGAATATCAACTTGAATGTACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022310.2-2278s1c1
Sequence:CCGGCTCGAATGTAATTGGAATCTTCTCGAGAAGATTCCAATTACATTCGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-2114s1c1
Sequence:CCGGGCCAATTATCAGCAAACTCTACTCGAGTAGAGTTTGCTGATAATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022310
HSPA5 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-697s21c1
Sequence:CCGGGGAGACTGCTGAGGCGTATTTCTCGAGAAATACGCCTCAGCAGTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-1586s21c1
Sequence:CCGGTTCTCCACGGCTTCCGATAATCTCGAGATTATCGGAAGCCGTGGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-2066s21c1
Sequence:CCGGGCGGACATTGAAGACTTTAAACTCGAGTTTAAAGTCTTCAATGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-1195s21c1
Sequence:CCGGGACCCTTACTCGGGCCAAATTCTCGAGAATTTGGCCCGAGTAAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022310.3-1844s21c1
Sequence:CCGGGAAATTGAAAGGATGGTTAATCTCGAGATTAACCATCCTTTCAATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022310.3-2391s21c1
Sequence:CCGGGAGAGGAGGAATTGGCTATTTCTCGAGAAATAGCCAATTCCTCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-1611s1c1
Sequence:CCGGGTAACAATCAAGGTCTATGAACTCGAGTTCATAGACCTTGATTGTTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-1492s1c1
Sequence:CCGGCCCTTACACTTGGTATTGAAACTCGAGTTTCAATACCAAGTGTAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-606s1c1
Sequence:CCGGCCGTACATTCAAGTTGATATTCTCGAGAATATCAACTTGAATGTACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008455    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022310.2-2278s1c1
Sequence:CCGGCTCGAATGTAATTGGAATCTTCTCGAGAAGATTCCAATTACATTCGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022310.2-2114s1c1
Sequence:CCGGGCCAATTATCAGCAAACTCTACTCGAGTAGAGTTTGCTGATAATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005347
VALIDATED
HSPA5 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005347.3-1865s21c1
Sequence:CCGGGAAATCGAAAGGATGGTTAATCTCGAGATTAACCATCCTTTCGATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005347.3-1365s21c1
Sequence:GTACCGGAGATTCAGCAACTGGTTAAAGCTCGAGCTTTAACCAGTTGCTGAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005347.3-1925s21c1
Sequence:GTACCGGGAGCGCATTGATACTAGAAATCTCGAGATTTCTAGTATCAATGCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005347.3-3026s21c1
Sequence:CCGGGTGAGTGATCACTGGTATTAACTCGAGTTAATACCAGTGATCACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005347.3-1402s21c1
Sequence:CCGGGGAACCATCCCGTGGCATAAACTCGAGTTTATGCCACGGGATGGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005347.x-2722s1c1
Sequence:CCGGGCTAATTGAGACCACAGGCTTCTCGAGAAGCCTGTGGTCTCAATTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005347.x-1285s1c1
Sequence:CCGGCTTGTTGGTGGCTCGACTCGACTCGAGTCGAGTCGAGCCACCAACAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005347.x-1593s1c1
Sequence:CCGGCAAGGTCTATGAAGGTGAAAGCTCGAGCTTTCACCTTCATAGACCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005347.x-1639s1c1
Sequence:CCGGCTGGGTACATTTGATCTGACTCTCGAGAGTCAGATCAAATGTACCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005347
VALIDATED
HSPA5 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005347.3-1865s21c1
Sequence:CCGGGAAATCGAAAGGATGGTTAATCTCGAGATTAACCATCCTTTCGATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005347.3-1365s21c1
Sequence:GTACCGGAGATTCAGCAACTGGTTAAAGCTCGAGCTTTAACCAGTTGCTGAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005347.3-1925s21c1
Sequence:GTACCGGGAGCGCATTGATACTAGAAATCTCGAGATTTCTAGTATCAATGCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000231124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005347.3-3026s21c1
Sequence:CCGGGTGAGTGATCACTGGTATTAACTCGAGTTAATACCAGTGATCACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005347.3-1402s21c1
Sequence:CCGGGGAACCATCCCGTGGCATAAACTCGAGTTTATGCCACGGGATGGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005347.x-2722s1c1
Sequence:CCGGGCTAATTGAGACCACAGGCTTCTCGAGAAGCCTGTGGTCTCAATTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005347.x-1285s1c1
Sequence:CCGGCTTGTTGGTGGCTCGACTCGACTCGAGTCGAGTCGAGCCACCAACAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005347.x-1593s1c1
Sequence:CCGGCAAGGTCTATGAAGGTGAAAGCTCGAGCTTTCACCTTCATAGACCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005347.x-1639s1c1
Sequence:CCGGCTGGGTACATTTGATCTGACTCTCGAGAGTCAGATCAAATGTACCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005347
VALIDATED
HSPA5 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_005347.3-1865s21c1
Sequence:CCGGGAAATCGAAAGGATGGTTAATCTCGAGATTAACCATCCTTTCGATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_005347.3-1365s21c1
Sequence:GTACCGGAGATTCAGCAACTGGTTAAAGCTCGAGCTTTAACCAGTTGCTGAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_005347.3-1925s21c1
Sequence:GTACCGGGAGCGCATTGATACTAGAAATCTCGAGATTTCTAGTATCAATGCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000231124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005347.3-3026s21c1
Sequence:CCGGGTGAGTGATCACTGGTATTAACTCGAGTTAATACCAGTGATCACTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005347.3-1402s21c1
Sequence:CCGGGGAACCATCCCGTGGCATAAACTCGAGTTTATGCCACGGGATGGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010573    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005347.x-2722s1c1
Sequence:CCGGGCTAATTGAGACCACAGGCTTCTCGAGAAGCCTGTGGTCTCAATTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005347.x-1285s1c1
Sequence:CCGGCTTGTTGGTGGCTCGACTCGACTCGAGTCGAGTCGAGCCACCAACAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005347.x-1593s1c1
Sequence:CCGGCAAGGTCTATGAAGGTGAAAGCTCGAGCTTTCACCTTCATAGACCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005347.x-1639s1c1
Sequence:CCGGCTGGGTACATTTGATCTGACTCTCGAGAGTCAGATCAAATGTACCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)