EMAIL THIS PAGE TO A FRIEND

HSPA6

heat shock 70kDa protein 6 (HSP70B')

21 Gene Product Result for
UniProtKB ID: P17066, Q1HBA8, Q8IYK7, Q9BT95
Gene ID:
cow(281830) heat shock 70kDa protein 6 (HSP70B')
cow(539835) heat shock 70kDa protein 6 (HSP70B')
domestic guinea pig(100715119) heat shock 70kDa protein 6 (HSP70B')
naked mole-rat(101701238) heat shock 70kDa protein 6 (HSP70B')
sheep(101107064) heat shock 70kDa protein 6 (HSP70B')
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002155 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034531 MISSION® esiRNA esiRNA human HSPA6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002155 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244824 predicted 1046
2 SASI_Hs01_00244827 predicted 2424
3 SASI_Hs01_00244829 predicted 1063
4 SASI_Hs01_00244825 predicted 2386
5 SASI_Hs01_00244826 predicted 1847
6 SASI_Hs01_00244828 predicted 1894
7 SASI_Hs01_00244830 predicted 2069
8 SASI_Hs01_00244831 predicted 2427
9 SASI_Hs01_00244832 predicted 1845
10 SASI_Hs01_00244833 predicted 1841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002155
HSPA6 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 6 (HSP70B')
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000187173    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002155.3-2464s1c1
Sequence:CCGGCCCAGGATAACTGAAGTCTTTCTCGAGAAAGACTTCAGTTATCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-2057s1c1
Sequence:CCGGCTTCCATGTGAAAGGTTCTTTCTCGAGAAAGAACCTTTCACATGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1898s1c1
Sequence:CCGGGAGCACAGGTAAGGCTAACAACTCGAGTTGTTAGCCTTACCTGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1035s1c1
Sequence:CCGGGATGTGTCGGTTCTCTCCATTCTCGAGAATGGAGAGAACCGACACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1842s1c1
Sequence:CCGGGAGGTGACCTTTGACATTGATCTCGAGATCAATGTCAAAGGTCACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1568s1c1
Sequence:CCGGCAAATGTGAGAAAGTGCAGGACTCGAGTCCTGCACTTTCTCACATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-1058s21c1
Sequence:CCGGCGCTGGTGTCTTTGAGGTGAACTCGAGTTCACCTCAAAGACACCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-2275s21c1
Sequence:CCGGGCAGCAGTTGTGGCACTCAAGCTCGAGCTTGAGTGCCACAACTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-1986s21c1
Sequence:CCGGGAGCAGTACAAGGCTGAGGATCTCGAGATCCTCAGCCTTGTACTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-924s21c1
Sequence:CCGGGTGTTGCGGATCATCAATGAGCTCGAGCTCATTGATGATCCGCAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002155
HSPA6 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 6 (HSP70B')
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000187173    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002155.3-2464s1c1
Sequence:CCGGCCCAGGATAACTGAAGTCTTTCTCGAGAAAGACTTCAGTTATCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-2057s1c1
Sequence:CCGGCTTCCATGTGAAAGGTTCTTTCTCGAGAAAGAACCTTTCACATGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1898s1c1
Sequence:CCGGGAGCACAGGTAAGGCTAACAACTCGAGTTGTTAGCCTTACCTGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1035s1c1
Sequence:CCGGGATGTGTCGGTTCTCTCCATTCTCGAGAATGGAGAGAACCGACACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1842s1c1
Sequence:CCGGGAGGTGACCTTTGACATTGATCTCGAGATCAATGTCAAAGGTCACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1568s1c1
Sequence:CCGGCAAATGTGAGAAAGTGCAGGACTCGAGTCCTGCACTTTCTCACATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-1058s21c1
Sequence:CCGGCGCTGGTGTCTTTGAGGTGAACTCGAGTTCACCTCAAAGACACCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-2275s21c1
Sequence:CCGGGCAGCAGTTGTGGCACTCAAGCTCGAGCTTGAGTGCCACAACTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-1986s21c1
Sequence:CCGGGAGCAGTACAAGGCTGAGGATCTCGAGATCCTCAGCCTTGTACTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-924s21c1
Sequence:CCGGGTGTTGCGGATCATCAATGAGCTCGAGCTCATTGATGATCCGCAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002155
HSPA6 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 6 (HSP70B')
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000187173    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002155.3-2464s1c1
Sequence:CCGGCCCAGGATAACTGAAGTCTTTCTCGAGAAAGACTTCAGTTATCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-2057s1c1
Sequence:CCGGCTTCCATGTGAAAGGTTCTTTCTCGAGAAAGAACCTTTCACATGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1898s1c1
Sequence:CCGGGAGCACAGGTAAGGCTAACAACTCGAGTTGTTAGCCTTACCTGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1035s1c1
Sequence:CCGGGATGTGTCGGTTCTCTCCATTCTCGAGAATGGAGAGAACCGACACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1842s1c1
Sequence:CCGGGAGGTGACCTTTGACATTGATCTCGAGATCAATGTCAAAGGTCACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002155.3-1568s1c1
Sequence:CCGGCAAATGTGAGAAAGTGCAGGACTCGAGTCCTGCACTTTCTCACATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-1058s21c1
Sequence:CCGGCGCTGGTGTCTTTGAGGTGAACTCGAGTTCACCTCAAAGACACCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-2275s21c1
Sequence:CCGGGCAGCAGTTGTGGCACTCAAGCTCGAGCTTGAGTGCCACAACTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-1986s21c1
Sequence:CCGGGAGCAGTACAAGGCTGAGGATCTCGAGATCCTCAGCCTTGTACTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002155.3-924s21c1
Sequence:CCGGGTGTTGCGGATCATCAATGAGCTCGAGCTCATTGATGATCCGCAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)