EMAIL THIS PAGE TO A FRIEND

HSPA8

heat shock 70kDa protein 8

83 Gene Product Result for
Synonyms: HSC54 HSC70 HSC71 HSP71 HSP73 HSPA10 LAP1 NIP71
UniProtKB ID: P11142, Q9H3R6
Gene ID:
Human(3312) Summary: This gene encodes a member of the heat shock protein 70 family, which contains both heat-inducible and constitutively expressed members. This protein belongs to the latter group, which are also referred to as heat-shock cognate proteins. It functions as a chaperone, and binds to nascent polypeptides to facilitate correct folding. It also functions as an ATPase in the disassembly of clathrin-coated vesicles during transport of membrane components through the cell. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(15481) heat shock protein 8
Rat(24468) heat shock 70kDa protein 8
Zebrafish(573376) heat shock protein 8
dog(479406) heat shock 70kDa protein 8
chicken(395853) heat shock 70kDa protein 8
domestic cat(101087422) heat shock 70kDa protein 8
cow(281831) heat shock 70kDa protein 8
Horse(100009679) heat shock 70kDa protein 8
sheep(101112844) heat shock 70kDa protein 8
sheep(100135701) heat shock 70kDa protein 8
domestic guinea pig(100713849) heat shock 70kDa protein 8
naked mole-rat(101708313) heat shock 70kDa protein 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108679 Anti-HSPA8 affinity isolated antibody goat, human, canine, pig, zebrafish, sheep, mouse, bovine
immunohistochemistry, western blot pricing
SAB2500521 Anti-HSPA8 (Isoform 1) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB2701704 Anti-hspa8 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701706 Anti-hspa8 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2701813 Anti-hspa8 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2101098 Anti-HSPA8 antibody produced in rabbit affinity isolated antibody Caenorhabditis elegans, Arabidopsis sp., rat, mouse, canine, human
western blot pricing
SAB2701964 Anti-HSPA8 antibody produced in rabbit human, mouse, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB2702050 Anti-HSPA8 antibody produced in rabbit human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2702054 Anti-HSPA8 antibody produced in rabbit pig, human, mouse
immunohistochemistry, western blot pricing
SAB2104919 Anti-HSPA8, (N-terminal) antibody produced in rabbit affinity isolated antibody Arabidopsis sp., mouse, rat, horse, Caenorhabditis elegans, canine, human
western blot pricing
SAB1412719 Monoclonal Anti-HSPA8 antibody produced in mouse clone 1G2, purified immunoglobulin human
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0829 AQUA Peptide FEELNADLF[R] human, mouse, rat pricing
AQ0805 AQUA Peptide VEIIANDQGN[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006597 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006597 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006597 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031165 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031165 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031165 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006597 Rosetta Predictions human pricing
NM_153201 Rosetta Predictions human pricing
NM_024351 Rosetta Predictions rat pricing
NM_031165 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006597 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148360 predicted 425
2 SASI_Hs01_00148361 predicted 434
3 SASI_Hs01_00148359 predicted 610
4 SASI_Hs02_00341905 predicted 438
5 SASI_Hs02_00341906 predicted 216
6 SASI_Hs02_00341907 predicted 241
7 SASI_Hs02_00341908 predicted 913
8 SASI_Hs02_00341909 predicted 835
9 SASI_Hs02_00341910 predicted 951
10 SASI_Hs02_00341911 predicted 1103
11 SASI_Hs01_00148362 predicted 1753
12 SASI_Hs01_00148363 predicted 1571
13 SASI_Hs01_00148364 predicted 1638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015077 predicted 429
2 SASI_Hs01_00015078 predicted 430
3 SASI_Hs01_00015076 predicted 609
4 SASI_Hs02_00367038 predicted 436
5 SASI_Hs02_00367039 predicted 216
6 SASI_Hs02_00367040 predicted 237
7 SASI_Hs02_00367041 predicted 912
8 SASI_Hs02_00367042 predicted 832
9 SASI_Hs02_00367043 predicted 949
10 SASI_Hs02_00367044 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263902 predicted 1493
2 SASI_Rn02_00263903 predicted 933
3 SASI_Rn02_00263904 predicted 1678
4 SASI_Rn02_00263905 predicted 1706
5 SASI_Rn01_00067530 predicted 1788
6 SASI_Rn01_00067531 predicted 704
7 SASI_Rn01_00067534 predicted 309
8 SASI_Rn02_00263906 predicted 575
9 SASI_Rn02_00263907 predicted 1245
10 SASI_Rn02_00263908 predicted 1130
11 SASI_Rn01_00067529 predicted 440
12 SASI_Rn01_00067532 predicted 1761
13 SASI_Rn01_00067533 predicted 1736
14 SASI_Rn01_00067535 predicted 1758
15 SASI_Rn01_00067536 predicted 572
16 SASI_Rn01_00067537 predicted 1839
17 SASI_Rn01_00067538 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336987 predicted 704
2 SASI_Mm01_00028063 predicted 1439
3 SASI_Mm02_00336988 predicted 709
4 SASI_Mm01_00028066 predicted 570
5 SASI_Mm01_00028067 predicted 930
6 SASI_Mm01_00028069 predicted 946
7 SASI_Mm01_00028070 predicted 1678
8 SASI_Mm02_00336989 predicted 608
9 SASI_Mm01_00028071 predicted 1233
10 SASI_Mm01_00028072 predicted 1791
11 SASI_Mm01_00028064 predicted 1325
12 SASI_Mm01_00028065 predicted 670
13 SASI_Mm01_00028068 predicted 636
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006597
VALIDATED
HSPA8 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 8
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-335s21c1
Sequence:GTACCGGATATGAAACATTGGCCCTTTACTCGAGTAAAGGGCCAATGTTTCATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-1811s21c1
Sequence:GTACCGGTCAACTGGCTTGATAAGAATCCTCGAGGATTCTTATCAAGCCAGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006597.3-2040s21c1
Sequence:GTACCGGGCATTGTTCCACACATTTAAACTCGAGTTTAAATGTGTGGAACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006597.3-2061s21c1
Sequence:GTACCGGACATTTGAAGGACCTAAATTCCTCGAGGAATTTAGGTCCTTCAAATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-964s21c1
Sequence:GTACCGGTCCATTACCCGTGCCCGATTTCTCGAGAAATCGGGCACGGGTAATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006597.3-2020s21c1
Sequence:GTACCGGGCCAACCAAGTGTAGATGTAGCTCGAGCTACATCTACACTTGGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-228s21c1
Sequence:GTACCGGGATCGGTGATGCCGCAAAGAACTCGAGTTCTTTGCGGCATCACCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-292s21c1
Sequence:GTACCGGCGTCTGATTGGACGCAGATTTCTCGAGAAATCTGCGTCCAATCAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-219s21c1
Sequence:GTACCGGTGAACGGTTGATCGGTGATGCCTCGAGGCATCACCGATCAACCGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-976s1c1
Sequence:CCGGGCCCGATTTGAAGAACTGAATCTCGAGATTCAGTTCTTCAAATCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1729s1c1
Sequence:CCGGGCAACTGTTGAAGATGAGAAACTCGAGTTTCTCATCTTCAACAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1128s1c1
Sequence:CCGGCCAAGACTTCTTCAATGGAAACTCGAGTTTCCATTGAAGAAGTCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1170s1c1
Sequence:CCGGCCCTGATGAAGCTGTTGCTTACTCGAGTAAGCAACAGCTTCATCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1997s1c1
Sequence:CCGGCCACCATTGAAGAGGTTGATTCTCGAGAATCAACCTCTTCAATGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006597
VALIDATED
HSPA8 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 8
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-335s21c1
Sequence:GTACCGGATATGAAACATTGGCCCTTTACTCGAGTAAAGGGCCAATGTTTCATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-1811s21c1
Sequence:GTACCGGTCAACTGGCTTGATAAGAATCCTCGAGGATTCTTATCAAGCCAGTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006597.3-2040s21c1
Sequence:GTACCGGGCATTGTTCCACACATTTAAACTCGAGTTTAAATGTGTGGAACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006597.3-2061s21c1
Sequence:GTACCGGACATTTGAAGGACCTAAATTCCTCGAGGAATTTAGGTCCTTCAAATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-964s21c1
Sequence:GTACCGGTCCATTACCCGTGCCCGATTTCTCGAGAAATCGGGCACGGGTAATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006597.3-2020s21c1
Sequence:GTACCGGGCCAACCAAGTGTAGATGTAGCTCGAGCTACATCTACACTTGGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-228s21c1
Sequence:GTACCGGGATCGGTGATGCCGCAAAGAACTCGAGTTCTTTGCGGCATCACCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-292s21c1
Sequence:GTACCGGCGTCTGATTGGACGCAGATTTCTCGAGAAATCTGCGTCCAATCAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-219s21c1
Sequence:GTACCGGTGAACGGTTGATCGGTGATGCCTCGAGGCATCACCGATCAACCGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-976s1c1
Sequence:CCGGGCCCGATTTGAAGAACTGAATCTCGAGATTCAGTTCTTCAAATCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1729s1c1
Sequence:CCGGGCAACTGTTGAAGATGAGAAACTCGAGTTTCTCATCTTCAACAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1128s1c1
Sequence:CCGGCCAAGACTTCTTCAATGGAAACTCGAGTTTCCATTGAAGAAGTCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1170s1c1
Sequence:CCGGCCCTGATGAAGCTGTTGCTTACTCGAGTAAGCAACAGCTTCATCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1997s1c1
Sequence:CCGGCCACCATTGAAGAGGTTGATTCTCGAGAATCAACCTCTTCAATGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006597
VALIDATED
HSPA8 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 8
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-335s21c1
Sequence:GTACCGGATATGAAACATTGGCCCTTTACTCGAGTAAAGGGCCAATGTTTCATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-1811s21c1
Sequence:GTACCGGTCAACTGGCTTGATAAGAATCCTCGAGGATTCTTATCAAGCCAGTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006597.3-2040s21c1
Sequence:GTACCGGGCATTGTTCCACACATTTAAACTCGAGTTTAAATGTGTGGAACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006597.3-2061s21c1
Sequence:GTACCGGACATTTGAAGGACCTAAATTCCTCGAGGAATTTAGGTCCTTCAAATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-964s21c1
Sequence:GTACCGGTCCATTACCCGTGCCCGATTTCTCGAGAAATCGGGCACGGGTAATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006597.3-2020s21c1
Sequence:GTACCGGGCCAACCAAGTGTAGATGTAGCTCGAGCTACATCTACACTTGGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-228s21c1
Sequence:GTACCGGGATCGGTGATGCCGCAAAGAACTCGAGTTCTTTGCGGCATCACCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-292s21c1
Sequence:GTACCGGCGTCTGATTGGACGCAGATTTCTCGAGAAATCTGCGTCCAATCAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006597.3-219s21c1
Sequence:GTACCGGTGAACGGTTGATCGGTGATGCCTCGAGGCATCACCGATCAACCGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-976s1c1
Sequence:CCGGGCCCGATTTGAAGAACTGAATCTCGAGATTCAGTTCTTCAAATCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1729s1c1
Sequence:CCGGGCAACTGTTGAAGATGAGAAACTCGAGTTTCTCATCTTCAACAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1128s1c1
Sequence:CCGGCCAAGACTTCTTCAATGGAAACTCGAGTTTCCATTGAAGAAGTCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1170s1c1
Sequence:CCGGCCCTGATGAAGCTGTTGCTTACTCGAGTAAGCAACAGCTTCATCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006597.3-1997s1c1
Sequence:CCGGCCACCATTGAAGAGGTTGATTCTCGAGAATCAACCTCTTCAATGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031165
HSPA8 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 8
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-815s21c1
Sequence:CCGGTCAAGCGAAAGCACAAGAAAGCTCGAGCTTTCTTGTGCTTTCGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-300s21c1
Sequence:GTACCGGGATCGGGCGTAGGTTTGATGACTCGAGTCATCAAACCTACGCCCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-146s21c1
Sequence:CCGGAGCATGGAAAGGTGGAAATTACTCGAGTAATTTCCACCTTTCCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-480s21c1
Sequence:CCGGGTACCTCGGAAAGACCGTTACCTCGAGGTAACGGTCTTTCCGAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-584s21c1
Sequence:CCGGATGTACTTCGAATCATCAATGCTCGAGCATTGATGATTCGAAGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-979s21c1
Sequence:CCGGGCTCGATTTGAGGAGTTGAATCTCGAGATTCAACTCCTCAAATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-193s21c1
Sequence:GTACCGGACGCCAAGCTATGTTGCTTTCCTCGAGGAAAGCAACATAGCTTGGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1628s1c1
Sequence:CCGGCGCTTGAGTAAGGAAGATATTCTCGAGAATATCTTCCTTACTCAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1627s1c1
Sequence:CCGGCCGCTTGAGTAAGGAAGATATCTCGAGATATCTTCCTTACTCAAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-329s1c1
Sequence:CCGGCGTAGGTTTGATGATGCTGTTCTCGAGAACAGCATCATCAAACCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1915s1c1
Sequence:CCGGCCCTATCATTACCAAGCTGTACTCGAGTACAGCTTGGTAATGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1001s1c1
Sequence:CCGGGCTCGATTTGAGGAGTTGAATCTCGAGATTCAACTCCTCAAATCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031165
HSPA8 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 8
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-815s21c1
Sequence:CCGGTCAAGCGAAAGCACAAGAAAGCTCGAGCTTTCTTGTGCTTTCGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-300s21c1
Sequence:GTACCGGGATCGGGCGTAGGTTTGATGACTCGAGTCATCAAACCTACGCCCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-146s21c1
Sequence:CCGGAGCATGGAAAGGTGGAAATTACTCGAGTAATTTCCACCTTTCCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-480s21c1
Sequence:CCGGGTACCTCGGAAAGACCGTTACCTCGAGGTAACGGTCTTTCCGAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-584s21c1
Sequence:CCGGATGTACTTCGAATCATCAATGCTCGAGCATTGATGATTCGAAGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-979s21c1
Sequence:CCGGGCTCGATTTGAGGAGTTGAATCTCGAGATTCAACTCCTCAAATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-193s21c1
Sequence:GTACCGGACGCCAAGCTATGTTGCTTTCCTCGAGGAAAGCAACATAGCTTGGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1628s1c1
Sequence:CCGGCGCTTGAGTAAGGAAGATATTCTCGAGAATATCTTCCTTACTCAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1627s1c1
Sequence:CCGGCCGCTTGAGTAAGGAAGATATCTCGAGATATCTTCCTTACTCAAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-329s1c1
Sequence:CCGGCGTAGGTTTGATGATGCTGTTCTCGAGAACAGCATCATCAAACCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1915s1c1
Sequence:CCGGCCCTATCATTACCAAGCTGTACTCGAGTACAGCTTGGTAATGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1001s1c1
Sequence:CCGGGCTCGATTTGAGGAGTTGAATCTCGAGATTCAACTCCTCAAATCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031165
HSPA8 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 8
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-815s21c1
Sequence:CCGGTCAAGCGAAAGCACAAGAAAGCTCGAGCTTTCTTGTGCTTTCGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-300s21c1
Sequence:GTACCGGGATCGGGCGTAGGTTTGATGACTCGAGTCATCAAACCTACGCCCGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-146s21c1
Sequence:CCGGAGCATGGAAAGGTGGAAATTACTCGAGTAATTTCCACCTTTCCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-480s21c1
Sequence:CCGGGTACCTCGGAAAGACCGTTACCTCGAGGTAACGGTCTTTCCGAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-584s21c1
Sequence:CCGGATGTACTTCGAATCATCAATGCTCGAGCATTGATGATTCGAAGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-979s21c1
Sequence:CCGGGCTCGATTTGAGGAGTTGAATCTCGAGATTCAACTCCTCAAATCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031165.4-193s21c1
Sequence:GTACCGGACGCCAAGCTATGTTGCTTTCCTCGAGGAAAGCAACATAGCTTGGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1628s1c1
Sequence:CCGGCGCTTGAGTAAGGAAGATATTCTCGAGAATATCTTCCTTACTCAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1627s1c1
Sequence:CCGGCCGCTTGAGTAAGGAAGATATCTCGAGATATCTTCCTTACTCAAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-329s1c1
Sequence:CCGGCGTAGGTTTGATGATGCTGTTCTCGAGAACAGCATCATCAAACCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1915s1c1
Sequence:CCGGCCCTATCATTACCAAGCTGTACTCGAGTACAGCTTGGTAATGATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031165.3-1001s1c1
Sequence:CCGGGCTCGATTTGAGGAGTTGAATCTCGAGATTCAACTCCTCAAATCGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)