EMAIL THIS PAGE TO A FRIEND

HSPA9

heat shock 70kDa protein 9 (mortalin)

73 Gene Product Result for
Synonyms: CSA GRP-75 GRP75 HSPA9B MOT MOT2 MTHSP75 PBP74
Gene ID:
Human(3313) Summary: This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
Mouse(15526) heat shock protein 9
Rat(291671) heat shock protein 9
Zebrafish(373085) heat shock protein 9
cow(517535) heat shock 70kDa protein 9 (mortalin)
Horse(100034032) heat shock 70kDa protein 9 (mortalin)
domestic cat(101089072) heat shock 70kDa protein 9 (mortalin)
dog(474697) heat shock 70kDa protein 9 (mortalin)
chicken(416183) heat shock 70kDa protein 9 (mortalin)
domestic guinea pig(100719079) heat shock 70kDa protein 9 (mortalin)
naked mole-rat(101715170) heat shock 70kDa protein 9 (mortalin)
sheep(101112054) heat shock 70kDa protein 9 (mortalin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004134 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004134 Rosetta Predictions human pricing
NM_001100658 Rosetta Predictions rat pricing
NM_010481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216923 predicted 1460
2 SASI_Hs01_00216924 predicted 1286
3 SASI_Hs01_00216925 predicted 1156
4 SASI_Hs01_00216927 predicted 596
5 SASI_Hs01_00216929 predicted 572
6 SASI_Hs01_00216930 predicted 739
7 SASI_Hs01_00216931 predicted 1512
8 SASI_Hs01_00216932 predicted 1735
9 SASI_Hs02_00336987 predicted 1184
10 SASI_Hs02_00336988 predicted 1829
11 SASI_Hs01_00216926 predicted 1500
12 SASI_Hs01_00216928 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210208 predicted 1300
2 SASI_Rn02_00210209 predicted 1613
3 SASI_Rn02_00210210 predicted 206
4 SASI_Rn02_00210211 predicted 1479
5 SASI_Rn02_00210212 predicted 1106
6 SASI_Rn02_00210213 predicted 828
7 SASI_Rn02_00210214 predicted 1418
8 SASI_Rn02_00210215 predicted 1076
9 SASI_Rn02_00210216 predicted 799
10 SASI_Rn02_00210217 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024693 predicted 1447
2 SASI_Mm01_00024694 predicted 930
3 SASI_Mm01_00024695 predicted 727
4 SASI_Mm01_00024696 predicted 2136
5 SASI_Mm02_00318716 predicted 1668
6 SASI_Mm01_00024697 predicted 2024
7 SASI_Mm01_00024698 predicted 578
8 SASI_Mm01_00024699 predicted 1150
9 SASI_Mm01_00024700 predicted 439
10 SASI_Mm01_00024701 predicted 2032
11 SASI_Mm01_00024692 predicted 1576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004134
VALIDATED
HSPA9 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 9 (mortalin)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-484s1c1
Sequence:CCGGCGGCGATATGATGATCCTGAACTCGAGTTCAGGATCATCATATCGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004134.4-1150s1c1
Sequence:CCGGCGTGCTCAATTTGAAGGGATTCTCGAGAATCCCTTCAAATTGAGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-595s1c1
Sequence:CCGGCCGAGTCAGATTGGAGCATTTCTCGAGAAATGCTCCAATCTGACTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-960s1c1
Sequence:CCGGGCACATTGTGAAGGAGTTCAACTCGAGTTGAACTCCTTCACAATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-433s1c1
Sequence:CCGGGCTGTCACCAACCCAAACAATCTCGAGATTGTTTGGGTTGGTGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-433s21c1
Sequence:CCGGGCTGTCACCAACCCAAACAATCTCGAGATTGTTTGGGTTGGTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-960s21c1
Sequence:CCGGGCACATTGTGAAGGAGTTCAACTCGAGTTGAACTCCTTCACAATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-595s21c1
Sequence:CCGGCCGAGTCAGATTGGAGCATTTCTCGAGAAATGCTCCAATCTGACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-484s21c1
Sequence:CCGGCGGCGATATGATGATCCTGAACTCGAGTTCAGGATCATCATATCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004134
VALIDATED
HSPA9 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 9 (mortalin)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-484s1c1
Sequence:CCGGCGGCGATATGATGATCCTGAACTCGAGTTCAGGATCATCATATCGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004134.4-1150s1c1
Sequence:CCGGCGTGCTCAATTTGAAGGGATTCTCGAGAATCCCTTCAAATTGAGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-595s1c1
Sequence:CCGGCCGAGTCAGATTGGAGCATTTCTCGAGAAATGCTCCAATCTGACTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-960s1c1
Sequence:CCGGGCACATTGTGAAGGAGTTCAACTCGAGTTGAACTCCTTCACAATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-433s1c1
Sequence:CCGGGCTGTCACCAACCCAAACAATCTCGAGATTGTTTGGGTTGGTGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-433s21c1
Sequence:CCGGGCTGTCACCAACCCAAACAATCTCGAGATTGTTTGGGTTGGTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-960s21c1
Sequence:CCGGGCACATTGTGAAGGAGTTCAACTCGAGTTGAACTCCTTCACAATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-595s21c1
Sequence:CCGGCCGAGTCAGATTGGAGCATTTCTCGAGAAATGCTCCAATCTGACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-484s21c1
Sequence:CCGGCGGCGATATGATGATCCTGAACTCGAGTTCAGGATCATCATATCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004134
VALIDATED
HSPA9 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 9 (mortalin)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-484s1c1
Sequence:CCGGCGGCGATATGATGATCCTGAACTCGAGTTCAGGATCATCATATCGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_004134.4-1150s1c1
Sequence:CCGGCGTGCTCAATTTGAAGGGATTCTCGAGAATCCCTTCAAATTGAGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-595s1c1
Sequence:CCGGCCGAGTCAGATTGGAGCATTTCTCGAGAAATGCTCCAATCTGACTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-960s1c1
Sequence:CCGGGCACATTGTGAAGGAGTTCAACTCGAGTTGAACTCCTTCACAATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004134.4-433s1c1
Sequence:CCGGGCTGTCACCAACCCAAACAATCTCGAGATTGTTTGGGTTGGTGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-433s21c1
Sequence:CCGGGCTGTCACCAACCCAAACAATCTCGAGATTGTTTGGGTTGGTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-960s21c1
Sequence:CCGGGCACATTGTGAAGGAGTTCAACTCGAGTTGAACTCCTTCACAATGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-595s21c1
Sequence:CCGGCCGAGTCAGATTGGAGCATTTCTCGAGAAATGCTCCAATCTGACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004134.5-484s21c1
Sequence:CCGGCGGCGATATGATGATCCTGAACTCGAGTTCAGGATCATCATATCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010481
VALIDATED
HSPA9 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 9 (mortalin)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010481.1-2268s1c1
Sequence:CCGGGCTAACTCATTTAATGGGTAACTCGAGTTACCCATTAAATGAGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010481.1-1996s1c1
Sequence:CCGGGCAGGCGTCATTGAAACTCTTCTCGAGAAGAGTTTCAATGACGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010481.1-275s1c1
Sequence:CCGGGCTGTTATGGAGGGCAAACAACTCGAGTTGTTTGCCCTCCATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010481.1-1553s1c1
Sequence:CCGGGCTGGAGACAACAAACTTCTACTCGAGTAGAAGTTTGTTGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010481.2-303s21c1
Sequence:CCGGGCTGTTATGGAGGGCAAACAACTCGAGTTGTTTGCCCTCCATAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010481.2-2024s21c1
Sequence:CCGGGCAGGCGTCATTGAAACTCTTCTCGAGAAGAGTTTCAATGACGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010481.2-2296s21c1
Sequence:CCGGGCTAACTCATTTAATGGGTAACTCGAGTTACCCATTAAATGAGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010481.2-1581s21c1
Sequence:CCGGGCTGGAGACAACAAACTTCTACTCGAGTAGAAGTTTGTTGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010481
VALIDATED
HSPA9 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 9 (mortalin)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010481.1-2268s1c1
Sequence:CCGGGCTAACTCATTTAATGGGTAACTCGAGTTACCCATTAAATGAGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010481.1-1996s1c1
Sequence:CCGGGCAGGCGTCATTGAAACTCTTCTCGAGAAGAGTTTCAATGACGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010481.1-275s1c1
Sequence:CCGGGCTGTTATGGAGGGCAAACAACTCGAGTTGTTTGCCCTCCATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010481.1-1553s1c1
Sequence:CCGGGCTGGAGACAACAAACTTCTACTCGAGTAGAAGTTTGTTGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010481.2-303s21c1
Sequence:CCGGGCTGTTATGGAGGGCAAACAACTCGAGTTGTTTGCCCTCCATAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010481.2-2024s21c1
Sequence:CCGGGCAGGCGTCATTGAAACTCTTCTCGAGAAGAGTTTCAATGACGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010481.2-2296s21c1
Sequence:CCGGGCTAACTCATTTAATGGGTAACTCGAGTTACCCATTAAATGAGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010481.2-1581s21c1
Sequence:CCGGGCTGGAGACAACAAACTTCTACTCGAGTAGAAGTTTGTTGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010481
VALIDATED
HSPA9 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 9 (mortalin)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010481.1-2268s1c1
Sequence:CCGGGCTAACTCATTTAATGGGTAACTCGAGTTACCCATTAAATGAGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010481.1-1996s1c1
Sequence:CCGGGCAGGCGTCATTGAAACTCTTCTCGAGAAGAGTTTCAATGACGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010481.1-275s1c1
Sequence:CCGGGCTGTTATGGAGGGCAAACAACTCGAGTTGTTTGCCCTCCATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010481.1-1553s1c1
Sequence:CCGGGCTGGAGACAACAAACTTCTACTCGAGTAGAAGTTTGTTGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010481.2-303s21c1
Sequence:CCGGGCTGTTATGGAGGGCAAACAACTCGAGTTGTTTGCCCTCCATAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010481.2-2024s21c1
Sequence:CCGGGCAGGCGTCATTGAAACTCTTCTCGAGAAGAGTTTCAATGACGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010481.2-2296s21c1
Sequence:CCGGGCTAACTCATTTAATGGGTAACTCGAGTTACCCATTAAATGAGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010481.2-1581s21c1
Sequence:CCGGGCTGGAGACAACAAACTTCTACTCGAGTAGAAGTTTGTTGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)