EMAIL THIS PAGE TO A FRIEND

HSPB11

heat shock protein family B (small), member 11

135 Gene Product Result for
Synonyms: C1orf41 HSPCO34 IFT25 PP25
UniProtKB ID: Q9Y547, A6NG57, D3DQ45, Q9Y684
Gene ID:
Mouse(72938) heat shock protein family B (small), member 11
Rat(685284) heat shock protein family B (small), member 11
domestic guinea pig(100735715) heat shock protein family B (small), member 11
naked mole-rat(101704947) heat shock protein family B (small), member 11
sheep(101120452) heat shock protein family B (small), member 11
Zebrafish(796767) heat shock protein, alpha-crystallin-related, b11
chicken(424654) heat shock protein family B (small), member 11
cow(616194) heat shock protein family B (small), member 11
domestic cat(101095512) heat shock protein family B (small), member 11
dog(100683945) heat shock protein family B (small), member 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016126 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016126 Rosetta Predictions human pricing
NM_001131002 Rosetta Predictions rat pricing
NM_028394 Rosetta Predictions mouse pricing
XM_204090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113935 predicted 251
2 SASI_Hs01_00113936 predicted 303
3 SASI_Hs01_00113938 predicted 240
4 SASI_Hs01_00113939 predicted 263
5 SASI_Hs01_00113937 predicted 302
6 SASI_Hs01_00113943 predicted 274
7 SASI_Hs02_00348912 predicted 307
8 SASI_Hs01_00113944 predicted 228
9 SASI_Hs01_00113941 predicted 306
10 SASI_Hs02_00348913 predicted 305
11 SASI_Hs01_00113940 predicted 260
12 SASI_Hs01_00113942 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001131002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256139 predicted 410
2 SASI_Rn02_00256140 predicted 353
3 SASI_Rn02_00256141 predicted 411
4 SASI_Rn02_00256142 predicted 403
5 SASI_Rn02_00256143 predicted 479
6 SASI_Rn02_00256144 predicted 382
7 SASI_Rn02_00256145 predicted 383
8 SASI_Rn02_00256146 predicted 366
9 SASI_Rn02_00256147 predicted 380
10 SASI_Rn02_00256148 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333790 predicted 256
2 SASI_Mm02_00333791 predicted 303
3 SASI_Mm02_00333792 predicted 213
4 SASI_Mm02_00333793 predicted 302
5 SASI_Mm02_00333794 predicted 264
6 SASI_Mm02_00333795 predicted 282
7 SASI_Mm02_00333796 predicted 277
8 SASI_Mm02_00333797 predicted 253
9 SASI_Mm02_00333798 predicted 298
10 SASI_Mm02_00333799 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_204090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245094 predicted 263
2 SASI_Mm01_00245095 predicted 312
3 SASI_Mm01_00245096 predicted 221
4 SASI_Mm01_00245097 predicted 312
5 SASI_Mm01_00245098 predicted 279
6 SASI_Mm01_00245099 predicted 287
7 SASI_Mm01_00245100 predicted 285
8 SASI_Mm01_00245101 predicted 260
9 SASI_Mm01_00245102 predicted 311
10 SASI_Mm01_00245103 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016126
VALIDATED
HSPB11 MISSION shRNA Bacterial Glycerol Stock
heat shock protein family B (small), member 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-262s1c1
Sequence:CCGGGTACAGACCTTGAAGATTGAACTCGAGTTCAATCTTCAAGGTCTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-289s1c1
Sequence:CCGGCGTCTAAAGAGCCAGTTGATTCTCGAGAATCAACTGGCTCTTTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-151s1c1
Sequence:CCGGGATGGGAATCCAGAAACGTTTCTCGAGAAACGTTTCTGGATTCCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-240s1c1
Sequence:CCGGGCTTGTAATCCAAAGTTACTTCTCGAGAAGTAACTTTGGATTACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-373s1c1
Sequence:CCGGTGGCACATGATGGCTCCGCTACTCGAGTAGCGGAGCCATCATGTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016126.2-281s21c1
Sequence:CCGGGTACAGACCTTGAAGATTGAACTCGAGTTCAATCTTCAAGGTCTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016126.2-170s21c1
Sequence:CCGGGATGGGAATCCAGAAACGTTTCTCGAGAAACGTTTCTGGATTCCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016126.2-259s21c1
Sequence:CCGGGCTTGTAATCCAAAGTTACTTCTCGAGAAGTAACTTTGGATTACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016126.2-309s21c1
Sequence:CCGGCGTCTAAAGAGCCAGTTGATTCTCGAGAATCAACTGGCTCTTTAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016126
VALIDATED
HSPB11 MISSION shRNA shRNA Plasmid DNA
heat shock protein family B (small), member 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-262s1c1
Sequence:CCGGGTACAGACCTTGAAGATTGAACTCGAGTTCAATCTTCAAGGTCTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-289s1c1
Sequence:CCGGCGTCTAAAGAGCCAGTTGATTCTCGAGAATCAACTGGCTCTTTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-151s1c1
Sequence:CCGGGATGGGAATCCAGAAACGTTTCTCGAGAAACGTTTCTGGATTCCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-240s1c1
Sequence:CCGGGCTTGTAATCCAAAGTTACTTCTCGAGAAGTAACTTTGGATTACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-373s1c1
Sequence:CCGGTGGCACATGATGGCTCCGCTACTCGAGTAGCGGAGCCATCATGTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016126.2-281s21c1
Sequence:CCGGGTACAGACCTTGAAGATTGAACTCGAGTTCAATCTTCAAGGTCTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016126.2-170s21c1
Sequence:CCGGGATGGGAATCCAGAAACGTTTCTCGAGAAACGTTTCTGGATTCCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016126.2-259s21c1
Sequence:CCGGGCTTGTAATCCAAAGTTACTTCTCGAGAAGTAACTTTGGATTACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016126.2-309s21c1
Sequence:CCGGCGTCTAAAGAGCCAGTTGATTCTCGAGAATCAACTGGCTCTTTAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016126
VALIDATED
HSPB11 MISSION shRNA Lentiviral Transduction Particles
heat shock protein family B (small), member 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-262s1c1
Sequence:CCGGGTACAGACCTTGAAGATTGAACTCGAGTTCAATCTTCAAGGTCTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-289s1c1
Sequence:CCGGCGTCTAAAGAGCCAGTTGATTCTCGAGAATCAACTGGCTCTTTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-151s1c1
Sequence:CCGGGATGGGAATCCAGAAACGTTTCTCGAGAAACGTTTCTGGATTCCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-240s1c1
Sequence:CCGGGCTTGTAATCCAAAGTTACTTCTCGAGAAGTAACTTTGGATTACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016126.1-373s1c1
Sequence:CCGGTGGCACATGATGGCTCCGCTACTCGAGTAGCGGAGCCATCATGTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016126.2-281s21c1
Sequence:CCGGGTACAGACCTTGAAGATTGAACTCGAGTTCAATCTTCAAGGTCTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016126.2-170s21c1
Sequence:CCGGGATGGGAATCCAGAAACGTTTCTCGAGAAACGTTTCTGGATTCCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016126.2-259s21c1
Sequence:CCGGGCTTGTAATCCAAAGTTACTTCTCGAGAAGTAACTTTGGATTACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016126.2-309s21c1
Sequence:CCGGCGTCTAAAGAGCCAGTTGATTCTCGAGAATCAACTGGCTCTTTAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028394
VALIDATED
HSPB11 MISSION shRNA Bacterial Glycerol Stock
heat shock protein family B (small), member 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-167s21c1
Sequence:CCGGCATTGATGGGAATCCGGAAACCTCGAGGTTTCCGGATTCCCATCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-273s21c1
Sequence:CCGGAGTTACTTGGTGCGGACTTTGCTCGAGCAAAGTCCGCACCAAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-106s21c1
Sequence:CCGGCTGAAGGGACAGAAGTGATTCCTCGAGGAATCACTTCTGTCCCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-192s21c1
Sequence:CCGGTGGACCACCACAGGCATGTTTCTCGAGAAACATGCCTGTGGTGGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-235s21c1
Sequence:CCGGTTCACAAACACGTAAAGATTGCTCGAGCAATCTTTACGTGTTTGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028394
VALIDATED
HSPB11 MISSION shRNA shRNA Plasmid DNA
heat shock protein family B (small), member 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-167s21c1
Sequence:CCGGCATTGATGGGAATCCGGAAACCTCGAGGTTTCCGGATTCCCATCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-273s21c1
Sequence:CCGGAGTTACTTGGTGCGGACTTTGCTCGAGCAAAGTCCGCACCAAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-106s21c1
Sequence:CCGGCTGAAGGGACAGAAGTGATTCCTCGAGGAATCACTTCTGTCCCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-192s21c1
Sequence:CCGGTGGACCACCACAGGCATGTTTCTCGAGAAACATGCCTGTGGTGGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-235s21c1
Sequence:CCGGTTCACAAACACGTAAAGATTGCTCGAGCAATCTTTACGTGTTTGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028394
VALIDATED
HSPB11 MISSION shRNA Lentiviral Transduction Particles
heat shock protein family B (small), member 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-167s21c1
Sequence:CCGGCATTGATGGGAATCCGGAAACCTCGAGGTTTCCGGATTCCCATCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-273s21c1
Sequence:CCGGAGTTACTTGGTGCGGACTTTGCTCGAGCAAAGTCCGCACCAAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-106s21c1
Sequence:CCGGCTGAAGGGACAGAAGTGATTCCTCGAGGAATCACTTCTGTCCCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-192s21c1
Sequence:CCGGTGGACCACCACAGGCATGTTTCTCGAGAAACATGCCTGTGGTGGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028394.2-235s21c1
Sequence:CCGGTTCACAAACACGTAAAGATTGCTCGAGCAATCTTTACGTGTTTGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)