EMAIL THIS PAGE TO A FRIEND

HSPB1

heat shock 27kDa protein 1

92 Gene Product Result for
Synonyms: CMT2F HMN2B HS.76067 HSP27 HSP28 Hsp25 SRP27
Gene ID:
Human(3315) Summary: The protein encoded by this gene is induced by environmental stress and developmental changes. The encoded protein is involved in stress resistance and actin organization and translocates from the cytoplasm to the nucleus upon stress induction. Defects in this gene are a cause of Charcot-Marie-Tooth disease type 2F (CMT2F) and distal hereditary motor neuropathy (dHMN). [provided by RefSeq, Oct 2008]
Mouse(15507) heat shock protein 1
Rat(24471) heat shock protein 1
Zebrafish(368243) heat shock protein, alpha-crystallin-related, 1
chicken(396227) heat shock 27kDa protein 1
cow(516099) heat shock 27kDa protein 1
domestic cat(101084411) heat shock 27kDa protein 1
dog(403979) heat shock 27kDa protein 1
sheep(101115754) heat shock 27kDa protein 1
domestic guinea pig(100724197) heat shock 27kDa protein 1
naked mole-rat(101716096) heat shock 27kDa protein 1
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
P1498 Anti-Heat Shock Protein 27 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, microarray, western blot pricing
H2289 Anti-Heat Shock Protein 27/25 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, canine, rat, human
immunofluorescence, microarray, western blot pricing
SAB1306362 ANTI-HSP27 (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306361 ANTI-HSP27 (HSPB1) (S78) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306031 ANTI-HSP27 (HSPB1) (S83) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4501456 Anti-HSP27 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4501457 Anti-HSP27 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4501455 Anti-HSP27, N-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4300415 Anti-HSPB1 (Ab-15) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300495 Anti-HSPB1 (Ab-78) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300496 Anti-HSPB1 (Ab-82) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
AV09060 Anti-HSPB1 (AB1) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
AV30177 Anti-HSPB1 (AB2) antibody produced in rabbit IgG fraction of antiserum human
immunohistochemistry, western blot pricing
HPA000497 Anti-HSPB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2701965 Anti-HSPB1 antibody produced in rabbit mouse, rat, human
flow cytometry, immunocytochemistry, immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB4504432 Anti-phospho-HSP27 (pSer15) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504433 Anti-phospho-HSP27 (pSer78) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4504434 Anti-phospho-HSP27 (pSer82) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300134 Anti-phospho-HSPB1 (pSer15) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300196 Anti-phospho-HSPB1 (pSer78) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300197 Anti-phospho-HSPB1 (pSer82) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
H0273 Monoclonal Anti-Heat Shock Protein 25 antibody produced in mouse clone IAP-28, ascites fluid guinea pig, mouse, frog, rabbit, chicken, rat, bovine, human, turkey, Drosophila
ELISA, immunofluorescence, immunohistochemistry, radioimmunoassay, western blot pricing
H0148 Monoclonal Anti-Heat Shock Protein 25 antibody produced in mouse clone IAP-9, ascites fluid human, rat, turkey, rabbit, mouse, chicken, guinea pig, frog
immunofluorescence, immunohistochemistry, microarray pricing
SAB3701437 Monoclonal Anti-HSP27 antibody produced in mouse clone G3.1, purified immunoglobulin human
ELISA, western blot pricing
WH0003315M4 Monoclonal Anti-HSPB1 antibody produced in mouse clone 3G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001540 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112501 MISSION® esiRNA esiRNA human HSPB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001540 Rosetta Predictions human pricing
NM_031970 Rosetta Predictions rat pricing
NM_013560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065611 predicted 312
2 SASI_Hs02_00332074 predicted 617
3 SASI_Hs02_00332075 predicted 504
4 SASI_Hs02_00332076 predicted 557
5 SASI_Hs01_00065604 predicted 420
6 SASI_Hs01_00065607 predicted 330
7 SASI_Hs02_00332077 predicted 300
8 SASI_Hs01_00065608 predicted 391
9 SASI_Hs01_00065612 predicted 481
10 SASI_Hs01_00065613 predicted 359
11 SASI_Hs01_00065605 predicted 482
12 SASI_Hs01_00065606 predicted 444
13 SASI_Hs01_00065609 predicted 391
14 SASI_Hs01_00065610 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093719 predicted 403
2 SASI_Rn01_00093720 predicted 478
3 SASI_Rn01_00093721 predicted 318
4 SASI_Rn01_00093722 predicted 378
5 SASI_Rn01_00093723 predicted 299
6 SASI_Rn01_00093725 predicted 472
7 SASI_Rn01_00093726 predicted 393
8 SASI_Rn01_00093727 predicted 378
9 SASI_Rn01_00093728 predicted 438
10 SASI_Rn02_00265355 predicted 463
11 SASI_Rn01_00093724 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138042 predicted 515
2 SASI_Mm02_00322288 predicted 550
3 SASI_Mm02_00322289 predicted 500
4 SASI_Mm02_00322290 predicted 675
5 SASI_Mm01_00138047 predicted 555
6 SASI_Mm02_00322291 predicted 676
7 SASI_Mm02_00322292 predicted 222
8 SASI_Mm02_00322293 predicted 663
9 SASI_Mm02_00322294 predicted 251
10 SASI_Mm02_00322295 predicted 421
11 SASI_Mm01_00138041 predicted 222
12 SASI_Mm01_00138043 predicted 414
13 SASI_Mm01_00138044 predicted 236
14 SASI_Mm01_00138045 predicted 217
15 SASI_Mm01_00138046 predicted 231
16 SASI_Mm01_00138048 predicted 323
17 SASI_Mm01_00138049 predicted 410
18 SASI_Mm01_00138050 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001540
VALIDATED
HSPB1 MISSION shRNA Bacterial Glycerol Stock
heat shock 27kDa protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001540.3-481s21c1
Sequence:CCGGTGACGGTCAAGACCAAGGATGCTCGAGCATCCTTGGTCTTGACCGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-470s21c1
Sequence:CCGGCCCGGACGAGCTGACGGTCAACTCGAGTTGACCGTCAGCTCGTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-274s21c1
Sequence:CCGGAGGAGTGGTCGCAGTGGTTAGCTCGAGCTAACCACTGCGACCACTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-560s21c1
Sequence:CCGGCCGGTGCTTCACGCGGAAATACTCGAGTATTTCCGCGTGAAGCACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-751s21c1
Sequence:CCGGCCGATGAGACTGCCGCCAAGTCTCGAGACTTGGCGGCAGTCTCATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-689s21c1
Sequence:CCGGGATCACCATCCCAGTCACCTTCTCGAGAAGGTGACTGGGATGGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-678s21c1
Sequence:CCGGCAGTCCAACGAGATCACCATCCTCGAGGATGGTGATCTCGTTGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001540.2-235s1c1
Sequence:CCGGCGCAGTGGTTAGGCGGCAGCACTCGAGTGCTGCCGCCTAACCACTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001540.2-422s1c1
Sequence:CCGGCCCGGACGAGCTGACGGTCAACTCGAGTTGACCGTCAGCTCGTCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001540.2-703s1c1
Sequence:CCGGCCGATGAGACTGCCGCCAAGTCTCGAGACTTGGCGGCAGTCTCATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001540.2-559s1c1
Sequence:CCGGCCCAAGTTTCCTCCTCCCTGTCTCGAGACAGGGAGGAGGAAACTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001540
VALIDATED
HSPB1 MISSION shRNA shRNA Plasmid DNA
heat shock 27kDa protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001540.3-481s21c1
Sequence:CCGGTGACGGTCAAGACCAAGGATGCTCGAGCATCCTTGGTCTTGACCGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-470s21c1
Sequence:CCGGCCCGGACGAGCTGACGGTCAACTCGAGTTGACCGTCAGCTCGTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-274s21c1
Sequence:CCGGAGGAGTGGTCGCAGTGGTTAGCTCGAGCTAACCACTGCGACCACTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-560s21c1
Sequence:CCGGCCGGTGCTTCACGCGGAAATACTCGAGTATTTCCGCGTGAAGCACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-751s21c1
Sequence:CCGGCCGATGAGACTGCCGCCAAGTCTCGAGACTTGGCGGCAGTCTCATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-689s21c1
Sequence:CCGGGATCACCATCCCAGTCACCTTCTCGAGAAGGTGACTGGGATGGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-678s21c1
Sequence:CCGGCAGTCCAACGAGATCACCATCCTCGAGGATGGTGATCTCGTTGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001540.2-235s1c1
Sequence:CCGGCGCAGTGGTTAGGCGGCAGCACTCGAGTGCTGCCGCCTAACCACTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001540.2-422s1c1
Sequence:CCGGCCCGGACGAGCTGACGGTCAACTCGAGTTGACCGTCAGCTCGTCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001540.2-703s1c1
Sequence:CCGGCCGATGAGACTGCCGCCAAGTCTCGAGACTTGGCGGCAGTCTCATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001540.2-559s1c1
Sequence:CCGGCCCAAGTTTCCTCCTCCCTGTCTCGAGACAGGGAGGAGGAAACTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001540
VALIDATED
HSPB1 MISSION shRNA Lentiviral Transduction Particles
heat shock 27kDa protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001540.3-481s21c1
Sequence:CCGGTGACGGTCAAGACCAAGGATGCTCGAGCATCCTTGGTCTTGACCGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-470s21c1
Sequence:CCGGCCCGGACGAGCTGACGGTCAACTCGAGTTGACCGTCAGCTCGTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-274s21c1
Sequence:CCGGAGGAGTGGTCGCAGTGGTTAGCTCGAGCTAACCACTGCGACCACTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-560s21c1
Sequence:CCGGCCGGTGCTTCACGCGGAAATACTCGAGTATTTCCGCGTGAAGCACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-751s21c1
Sequence:CCGGCCGATGAGACTGCCGCCAAGTCTCGAGACTTGGCGGCAGTCTCATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-689s21c1
Sequence:CCGGGATCACCATCCCAGTCACCTTCTCGAGAAGGTGACTGGGATGGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001540.3-678s21c1
Sequence:CCGGCAGTCCAACGAGATCACCATCCTCGAGGATGGTGATCTCGTTGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001540.2-235s1c1
Sequence:CCGGCGCAGTGGTTAGGCGGCAGCACTCGAGTGCTGCCGCCTAACCACTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001540.2-422s1c1
Sequence:CCGGCCCGGACGAGCTGACGGTCAACTCGAGTTGACCGTCAGCTCGTCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001540.2-703s1c1
Sequence:CCGGCCGATGAGACTGCCGCCAAGTCTCGAGACTTGGCGGCAGTCTCATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001540.2-559s1c1
Sequence:CCGGCCCAAGTTTCCTCCTCCCTGTCTCGAGACAGGGAGGAGGAAACTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013560
HSPB1 MISSION shRNA Bacterial Glycerol Stock
heat shock 27kDa protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-557s21c1
Sequence:CCGGTCGGTGCTTCACCCGGAAATACTCGAGTATTTCCGGGTGAAGCACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-606s21c1
Sequence:CCGGCTAGTGTCCTCTTCCCTATCCCTCGAGGGATAGGGAAGAGGACACTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-687s21c1
Sequence:CCGGATCACCATTCCGGTTACTTTCCTCGAGGAAAGTAACCGGAATGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-222s21c1
Sequence:CCGGCGCCTCTTCGATCAAGCTTTCCTCGAGGAAAGCTTGATCGAAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-512s21c1
Sequence:CCGGCACTGGCAAGCACGAAGAAAGCTCGAGCTTTCTTCGTGCTTGCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-120s1c1
Sequence:CCGGCGATGAGTGGTCGCAGTGGTTCTCGAGAACCACTGCGACCACTCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-268s1c1
Sequence:CCGGGAGATCCGACAGACGGCTGATCTCGAGATCAGCCGTCTGTCGGATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-412s1c1
Sequence:CCGGTCTCGGTGCTTCACCCGGAAACTCGAGTTTCCGGGTGAAGCACCGAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-81s1c1
Sequence:CCGGCCGCCTCTTCGATCAAGCTTTCTCGAGAAAGCTTGATCGAAGAGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-69s1c1
Sequence:CCGGCCCTGCACACAGCCGCCTCTTCTCGAGAAGAGGCGGCTGTGTGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013560
HSPB1 MISSION shRNA shRNA Plasmid DNA
heat shock 27kDa protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-557s21c1
Sequence:CCGGTCGGTGCTTCACCCGGAAATACTCGAGTATTTCCGGGTGAAGCACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-606s21c1
Sequence:CCGGCTAGTGTCCTCTTCCCTATCCCTCGAGGGATAGGGAAGAGGACACTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-687s21c1
Sequence:CCGGATCACCATTCCGGTTACTTTCCTCGAGGAAAGTAACCGGAATGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-222s21c1
Sequence:CCGGCGCCTCTTCGATCAAGCTTTCCTCGAGGAAAGCTTGATCGAAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-512s21c1
Sequence:CCGGCACTGGCAAGCACGAAGAAAGCTCGAGCTTTCTTCGTGCTTGCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-120s1c1
Sequence:CCGGCGATGAGTGGTCGCAGTGGTTCTCGAGAACCACTGCGACCACTCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-268s1c1
Sequence:CCGGGAGATCCGACAGACGGCTGATCTCGAGATCAGCCGTCTGTCGGATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-412s1c1
Sequence:CCGGTCTCGGTGCTTCACCCGGAAACTCGAGTTTCCGGGTGAAGCACCGAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-81s1c1
Sequence:CCGGCCGCCTCTTCGATCAAGCTTTCTCGAGAAAGCTTGATCGAAGAGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-69s1c1
Sequence:CCGGCCCTGCACACAGCCGCCTCTTCTCGAGAAGAGGCGGCTGTGTGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013560
HSPB1 MISSION shRNA Lentiviral Transduction Particles
heat shock 27kDa protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-557s21c1
Sequence:CCGGTCGGTGCTTCACCCGGAAATACTCGAGTATTTCCGGGTGAAGCACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-606s21c1
Sequence:CCGGCTAGTGTCCTCTTCCCTATCCCTCGAGGGATAGGGAAGAGGACACTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-687s21c1
Sequence:CCGGATCACCATTCCGGTTACTTTCCTCGAGGAAAGTAACCGGAATGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-222s21c1
Sequence:CCGGCGCCTCTTCGATCAAGCTTTCCTCGAGGAAAGCTTGATCGAAGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013560.2-512s21c1
Sequence:CCGGCACTGGCAAGCACGAAGAAAGCTCGAGCTTTCTTCGTGCTTGCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-120s1c1
Sequence:CCGGCGATGAGTGGTCGCAGTGGTTCTCGAGAACCACTGCGACCACTCATCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-268s1c1
Sequence:CCGGGAGATCCGACAGACGGCTGATCTCGAGATCAGCCGTCTGTCGGATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-412s1c1
Sequence:CCGGTCTCGGTGCTTCACCCGGAAACTCGAGTTTCCGGGTGAAGCACCGAGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-81s1c1
Sequence:CCGGCCGCCTCTTCGATCAAGCTTTCTCGAGAAAGCTTGATCGAAGAGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013560.1-69s1c1
Sequence:CCGGCCCTGCACACAGCCGCCTCTTCTCGAGAAGAGGCGGCTGTGTGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)