EMAIL THIS PAGE TO A FRIEND

HSPB2

heat shock 27kDa protein 2

76 Gene Product Result for
Synonyms: HSP27 Hs.78846 LOH11CR1K MKBP
UniProtKB ID: Q16082, Q6I9U7
Gene ID:
Human(3316) Summary: The protein encoded by this gene belongs to the superfamily of small heat-shock proteins containing a conservative alpha-crystallin domain at the C-terminal part of the molecule. The protein is expressed preferentially in the heart and skeletal muscle. This protein regulates Myotonic Dystrophy Protein Kinase, which plays an important role in maintenance of muscle structure and function. [provided by RefSeq, Dec 2012]
Mouse(69253) heat shock protein 2
Rat(161476) heat shock protein beta 2
Zebrafish(550439) heat shock protein, alpha-crystallin-related, b2
chicken(414136) heat shock 27kDa protein 2
cow(508671) heat shock 27kDa protein 2
domestic cat(101093207) heat shock 27kDa protein 2
dog(611362) heat shock 27kDa protein 2
sheep(101107895) heat shock 27kDa protein 2
domestic guinea pig(100736126) heat shock 27kDa protein 2
naked mole-rat(101696308) heat shock 27kDa protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001541 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001541 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001541 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024441 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024441 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024441 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001541 Rosetta Predictions human pricing
NM_130431 Rosetta Predictions rat pricing
NM_024441 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049624 predicted 458
2 SASI_Hs01_00049625 predicted 458
3 SASI_Hs01_00049626 predicted 393
4 SASI_Hs01_00049628 predicted 411
5 SASI_Hs01_00049629 predicted 267
6 SASI_Hs01_00049630 predicted 503
7 SASI_Hs01_00049631 predicted 383
8 SASI_Hs02_00332078 predicted 523
9 SASI_Hs01_00049632 predicted 384
10 SASI_Hs01_00049633 predicted 307
11 SASI_Hs01_00049627 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069853 predicted 328
2 SASI_Rn01_00069854 predicted 322
3 SASI_Rn01_00069855 predicted 267
4 SASI_Rn01_00069856 predicted 261
5 SASI_Rn01_00069857 predicted 229
6 SASI_Rn01_00069858 predicted 201
7 SASI_Rn01_00069859 predicted 196
8 SASI_Rn01_00069861 predicted 313
9 SASI_Rn02_00267453 predicted 248
10 SASI_Rn01_00069862 predicted 310
11 SASI_Rn01_00069860 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152204 predicted 364
2 SASI_Mm01_00152205 predicted 484
3 SASI_Mm01_00152206 predicted 374
4 SASI_Mm01_00152207 predicted 348
5 SASI_Mm02_00327773 predicted 333
6 SASI_Mm01_00152208 predicted 238
7 SASI_Mm01_00152209 predicted 351
8 SASI_Mm01_00152210 predicted 268
9 SASI_Mm01_00152211 predicted 543
10 SASI_Mm01_00152212 predicted 483
11 SASI_Mm01_00152213 predicted 361
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001541
VALIDATED
HSPB2 MISSION shRNA Bacterial Glycerol Stock
heat shock 27kDa protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-426s21c1
Sequence:CCGGGCTTCGTGTCCCGAGAGTTCTCTCGAGAGAACTCTCGGGACACGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-549s21c1
Sequence:CCGGATTTGGACACAGAGGTCAATGCTCGAGCATTGACCTCTGTGTCCAAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-219s21c1
Sequence:CCGGCACTCTACCATGGCTACTATGCTCGAGCATAGTAGCCATGGTAGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001541.x-266s1c1
Sequence:CCGGGAGGGCAAGTTCCAGGCATTTCTCGAGAAATGCCTGGAACTTGCCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001541.x-620s1c1
Sequence:CCGGCACCCAGCAAATCCCTCTCTACTCGAGTAGAGAGGGATTTGCTGGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001541.x-313s1c1
Sequence:CCGGCGAGGTGACTGTGAGGACTGTCTCGAGACAGTCCTCACAGTCACCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-560s21c1
Sequence:CCGGGAGGTCAATGAGGTCTACATCCTCGAGGATGTAGACCTCATTGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001541.3-675s21c1
Sequence:CCGGCTCTACCTCCCAAGGTGATATCTCGAGATATCACCTTGGGAGGTAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-625s21c1
Sequence:CCGGAGCCATAGTTGAGCCCTGATTCTCGAGAATCAGGGCTCAACTATGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001541.x-319s1c1
Sequence:CCGGGACTGTGAGGACTGTGGATAACTCGAGTTATCCACAGTCCTCACAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001541.x-328s1c1
Sequence:CCGGGACTGTGGATAACCTGCTGGACTCGAGTCCAGCAGGTTATCCACAGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001541
VALIDATED
HSPB2 MISSION shRNA shRNA Plasmid DNA
heat shock 27kDa protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-426s21c1
Sequence:CCGGGCTTCGTGTCCCGAGAGTTCTCTCGAGAGAACTCTCGGGACACGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-549s21c1
Sequence:CCGGATTTGGACACAGAGGTCAATGCTCGAGCATTGACCTCTGTGTCCAAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-219s21c1
Sequence:CCGGCACTCTACCATGGCTACTATGCTCGAGCATAGTAGCCATGGTAGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001541.x-266s1c1
Sequence:CCGGGAGGGCAAGTTCCAGGCATTTCTCGAGAAATGCCTGGAACTTGCCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001541.x-620s1c1
Sequence:CCGGCACCCAGCAAATCCCTCTCTACTCGAGTAGAGAGGGATTTGCTGGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001541.x-313s1c1
Sequence:CCGGCGAGGTGACTGTGAGGACTGTCTCGAGACAGTCCTCACAGTCACCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-560s21c1
Sequence:CCGGGAGGTCAATGAGGTCTACATCCTCGAGGATGTAGACCTCATTGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001541.3-675s21c1
Sequence:CCGGCTCTACCTCCCAAGGTGATATCTCGAGATATCACCTTGGGAGGTAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-625s21c1
Sequence:CCGGAGCCATAGTTGAGCCCTGATTCTCGAGAATCAGGGCTCAACTATGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001541.x-319s1c1
Sequence:CCGGGACTGTGAGGACTGTGGATAACTCGAGTTATCCACAGTCCTCACAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001541.x-328s1c1
Sequence:CCGGGACTGTGGATAACCTGCTGGACTCGAGTCCAGCAGGTTATCCACAGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001541
VALIDATED
HSPB2 MISSION shRNA Lentiviral Transduction Particles
heat shock 27kDa protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-426s21c1
Sequence:CCGGGCTTCGTGTCCCGAGAGTTCTCTCGAGAGAACTCTCGGGACACGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-549s21c1
Sequence:CCGGATTTGGACACAGAGGTCAATGCTCGAGCATTGACCTCTGTGTCCAAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-219s21c1
Sequence:CCGGCACTCTACCATGGCTACTATGCTCGAGCATAGTAGCCATGGTAGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001541.x-266s1c1
Sequence:CCGGGAGGGCAAGTTCCAGGCATTTCTCGAGAAATGCCTGGAACTTGCCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003812    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001541.x-620s1c1
Sequence:CCGGCACCCAGCAAATCCCTCTCTACTCGAGTAGAGAGGGATTTGCTGGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001541.x-313s1c1
Sequence:CCGGCGAGGTGACTGTGAGGACTGTCTCGAGACAGTCCTCACAGTCACCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-560s21c1
Sequence:CCGGGAGGTCAATGAGGTCTACATCCTCGAGGATGTAGACCTCATTGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413863    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001541.3-675s21c1
Sequence:CCGGCTCTACCTCCCAAGGTGATATCTCGAGATATCACCTTGGGAGGTAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001541.3-625s21c1
Sequence:CCGGAGCCATAGTTGAGCCCTGATTCTCGAGAATCAGGGCTCAACTATGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001541.x-319s1c1
Sequence:CCGGGACTGTGAGGACTGTGGATAACTCGAGTTATCCACAGTCCTCACAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001541.x-328s1c1
Sequence:CCGGGACTGTGGATAACCTGCTGGACTCGAGTCCAGCAGGTTATCCACAGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024441
VALIDATED
HSPB2 MISSION shRNA Bacterial Glycerol Stock
heat shock 27kDa protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-365s1c1
Sequence:CCGGCCGAGAGTTCTGTCGCACCTACTCGAGTAGGTGCGACAGAACTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-147s1c1
Sequence:CCGGACCCTCTATCACGGCTACTATCTCGAGATAGTAGCCGTGATAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024441.2-429s1c1
Sequence:CCGGCTATCCCATGATGGCATCCTTCTCGAGAAGGATGCCATCATGGGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-485s1c1
Sequence:CCGGCACGGAAGTCAATGAAGTCTACTCGAGTAGACTTCATTGACTTCCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-614s1c1
Sequence:CCGGCCTCCCGTGGTGATTCCATAACTCGAGTTATGGAATCACCACGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024441
VALIDATED
HSPB2 MISSION shRNA shRNA Plasmid DNA
heat shock 27kDa protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-365s1c1
Sequence:CCGGCCGAGAGTTCTGTCGCACCTACTCGAGTAGGTGCGACAGAACTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-147s1c1
Sequence:CCGGACCCTCTATCACGGCTACTATCTCGAGATAGTAGCCGTGATAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024441.2-429s1c1
Sequence:CCGGCTATCCCATGATGGCATCCTTCTCGAGAAGGATGCCATCATGGGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-485s1c1
Sequence:CCGGCACGGAAGTCAATGAAGTCTACTCGAGTAGACTTCATTGACTTCCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-614s1c1
Sequence:CCGGCCTCCCGTGGTGATTCCATAACTCGAGTTATGGAATCACCACGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024441
VALIDATED
HSPB2 MISSION shRNA Lentiviral Transduction Particles
heat shock 27kDa protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-365s1c1
Sequence:CCGGCCGAGAGTTCTGTCGCACCTACTCGAGTAGGTGCGACAGAACTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-147s1c1
Sequence:CCGGACCCTCTATCACGGCTACTATCTCGAGATAGTAGCCGTGATAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024441.2-429s1c1
Sequence:CCGGCTATCCCATGATGGCATCCTTCTCGAGAAGGATGCCATCATGGGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-485s1c1
Sequence:CCGGCACGGAAGTCAATGAAGTCTACTCGAGTAGACTTCATTGACTTCCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_024441.2-614s1c1
Sequence:CCGGCCTCCCGTGGTGATTCCATAACTCGAGTTATGGAATCACCACGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)