EMAIL THIS PAGE TO A FRIEND

HSPB3

heat shock 27kDa protein 3

49 Gene Product Result for
Synonyms: DHMN2C HMN2C HSPL27
UniProtKB ID: Q12988
Gene ID:
Human(8988) Summary: This gene encodes a muscle-specific small heat shock protein. A mutation in this gene is the cause of autosomal dominant distal hereditary motor neuropathy type 2C.[provided by RefSeq, Sep 2010]
Mouse(56534) heat shock protein 3
Rat(78951) heat shock protein 3
Zebrafish(568180) heat shock protein, alpha-crystallin-related, b3
dog(479334) heat shock 27kDa protein 3
cow(616007) heat shock 27kDa protein 3
domestic cat(101088721) heat shock 27kDa protein 3
chicken(431593) heat shock 27kDa protein 3
domestic guinea pig(100725925) heat shock 27kDa protein 3
naked mole-rat(101698608) heat shock 27kDa protein 3
sheep(101118384) heat shock 27kDa protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006308 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042541 MISSION® esiRNA esiRNA human HSPB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006308 Rosetta Predictions human pricing
NM_031750 Rosetta Predictions rat pricing
NM_019960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162356 predicted 430
2 SASI_Hs01_00162357 predicted 254
3 SASI_Hs01_00162358 predicted 478
4 SASI_Hs01_00162359 predicted 532
5 SASI_Hs01_00162360 predicted 442
6 SASI_Hs01_00162361 predicted 260
7 SASI_Hs01_00162362 predicted 254
8 SASI_Hs01_00162363 predicted 225
9 SASI_Hs01_00162364 predicted 413
10 SASI_Hs02_00341327 predicted 366
11 SASI_Hs01_00162365 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086738 predicted 223
2 SASI_Rn02_00265161 predicted 484
3 SASI_Rn01_00086740 predicted 230
4 SASI_Rn01_00086741 predicted 459
5 SASI_Rn01_00086742 predicted 198
6 SASI_Rn01_00086743 predicted 458
7 SASI_Rn01_00086744 predicted 409
8 SASI_Rn01_00086747 predicted 469
9 SASI_Rn02_00265162 predicted 292
10 SASI_Rn02_00265163 predicted 288
11 SASI_Rn01_00086739 predicted 491
12 SASI_Rn01_00086745 predicted 392
13 SASI_Rn01_00086746 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161183 predicted 282
2 SASI_Mm01_00161184 predicted 489
3 SASI_Mm02_00325260 predicted 242
4 SASI_Mm01_00161185 predicted 246
5 SASI_Mm01_00161186 predicted 200
6 SASI_Mm02_00325261 predicted 218
7 SASI_Mm01_00161188 predicted 213
8 SASI_Mm01_00161189 predicted 248
9 SASI_Mm01_00161190 predicted 204
10 SASI_Mm02_00325262 predicted 241
11 SASI_Mm01_00161182 predicted 497
12 SASI_Mm01_00161187 predicted 347
13 SASI_Mm01_00161191 predicted 497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006308
HSPB3 MISSION shRNA Bacterial Glycerol Stock
heat shock 27kDa protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-368s1c1
Sequence:CCGGCGAGAAGGCAAATCCCACTTTCTCGAGAAAGTGGGATTTGCCTTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006308.1-203s21c1
Sequence:CCGGATAGAGATTCCAGTGCGTTACCTCGAGGTAACGCACTGGAATCTCTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006308.1-510s21c1
Sequence:CCGGGAAGCTTCACCCGACAGTACACTCGAGTGTACTGTCGGGTGAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-548s1c1
Sequence:CCGGGAAATCAAAGATTTGTCTGCACTCGAGTGCAGACAAATCTTTGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-539s1c1
Sequence:CCGGGATGGCGTGGAAATCAAAGATCTCGAGATCTTTGATTTCCACGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-376s1c1
Sequence:CCGGCAAATCCCACTTTCAGATCCTCTCGAGAGGATCTGAAAGTGGGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-593s1c1
Sequence:CCGGGTGGTGGAAGTAAAGGATCCACTCGAGTGGATCCTTTACTTCCACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-470s1c1
Sequence:CCGGCAACACGGAACCAGAATGGATCTCGAGATCCATTCTGGTTCCGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-481s1c1
Sequence:CCGGCAGAATGGATGAGCACGGTTTCTCGAGAAACCGTGCTCATCCATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006308.1-562s21c1
Sequence:CCGGGTCTGCAGTCCTCTGTCATGACTCGAGTCATGACAGAGGACTGCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006308
HSPB3 MISSION shRNA shRNA Plasmid DNA
heat shock 27kDa protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-368s1c1
Sequence:CCGGCGAGAAGGCAAATCCCACTTTCTCGAGAAAGTGGGATTTGCCTTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006308.1-203s21c1
Sequence:CCGGATAGAGATTCCAGTGCGTTACCTCGAGGTAACGCACTGGAATCTCTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006308.1-510s21c1
Sequence:CCGGGAAGCTTCACCCGACAGTACACTCGAGTGTACTGTCGGGTGAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-548s1c1
Sequence:CCGGGAAATCAAAGATTTGTCTGCACTCGAGTGCAGACAAATCTTTGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-539s1c1
Sequence:CCGGGATGGCGTGGAAATCAAAGATCTCGAGATCTTTGATTTCCACGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-376s1c1
Sequence:CCGGCAAATCCCACTTTCAGATCCTCTCGAGAGGATCTGAAAGTGGGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-593s1c1
Sequence:CCGGGTGGTGGAAGTAAAGGATCCACTCGAGTGGATCCTTTACTTCCACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-470s1c1
Sequence:CCGGCAACACGGAACCAGAATGGATCTCGAGATCCATTCTGGTTCCGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-481s1c1
Sequence:CCGGCAGAATGGATGAGCACGGTTTCTCGAGAAACCGTGCTCATCCATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006308.1-562s21c1
Sequence:CCGGGTCTGCAGTCCTCTGTCATGACTCGAGTCATGACAGAGGACTGCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006308
HSPB3 MISSION shRNA Lentiviral Transduction Particles
heat shock 27kDa protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-368s1c1
Sequence:CCGGCGAGAAGGCAAATCCCACTTTCTCGAGAAAGTGGGATTTGCCTTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006308.1-203s21c1
Sequence:CCGGATAGAGATTCCAGTGCGTTACCTCGAGGTAACGCACTGGAATCTCTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006308.1-510s21c1
Sequence:CCGGGAAGCTTCACCCGACAGTACACTCGAGTGTACTGTCGGGTGAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-548s1c1
Sequence:CCGGGAAATCAAAGATTTGTCTGCACTCGAGTGCAGACAAATCTTTGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-539s1c1
Sequence:CCGGGATGGCGTGGAAATCAAAGATCTCGAGATCTTTGATTTCCACGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-376s1c1
Sequence:CCGGCAAATCCCACTTTCAGATCCTCTCGAGAGGATCTGAAAGTGGGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-593s1c1
Sequence:CCGGGTGGTGGAAGTAAAGGATCCACTCGAGTGGATCCTTTACTTCCACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-470s1c1
Sequence:CCGGCAACACGGAACCAGAATGGATCTCGAGATCCATTCTGGTTCCGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006308.1-481s1c1
Sequence:CCGGCAGAATGGATGAGCACGGTTTCTCGAGAAACCGTGCTCATCCATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006308.1-562s21c1
Sequence:CCGGGTCTGCAGTCCTCTGTCATGACTCGAGTCATGACAGAGGACTGCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019960
HSPB3 MISSION shRNA Bacterial Glycerol Stock
heat shock 27kDa protein 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-528s1c1
Sequence:CCGGCAGTACAAACTGCCAGATGGACTCGAGTCCATCTGGCAGTTTGTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-549s1c1
Sequence:CCGGGTCGAAACCAAAGATTTGTCTCTCGAGAGACAAATCTTTGGTTTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-575s1c1
Sequence:CCGGCCTCTGTCATGATGGAATCTTCTCGAGAAGATTCCATCATGACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-515s1c1
Sequence:CCGGGAGTTTCACCAGACAGTACAACTCGAGTTGTACTGTCTGGTGAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-487s1c1
Sequence:CCGGGAATGGACGAACACGGGTTTACTCGAGTAAACCCGTGTTCGTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-608s1c1
Sequence:CCGGCAAAGATTCACTAGGGACCAACTCGAGTTGGTCCCTAGTGAATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-207s1c1
Sequence:CCGGGTGCGTTATCAGGAGGAGTTTCTCGAGAAACTCCTCCTGATAACGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019960
HSPB3 MISSION shRNA shRNA Plasmid DNA
heat shock 27kDa protein 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-528s1c1
Sequence:CCGGCAGTACAAACTGCCAGATGGACTCGAGTCCATCTGGCAGTTTGTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-549s1c1
Sequence:CCGGGTCGAAACCAAAGATTTGTCTCTCGAGAGACAAATCTTTGGTTTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-575s1c1
Sequence:CCGGCCTCTGTCATGATGGAATCTTCTCGAGAAGATTCCATCATGACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-515s1c1
Sequence:CCGGGAGTTTCACCAGACAGTACAACTCGAGTTGTACTGTCTGGTGAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-487s1c1
Sequence:CCGGGAATGGACGAACACGGGTTTACTCGAGTAAACCCGTGTTCGTCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-608s1c1
Sequence:CCGGCAAAGATTCACTAGGGACCAACTCGAGTTGGTCCCTAGTGAATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-207s1c1
Sequence:CCGGGTGCGTTATCAGGAGGAGTTTCTCGAGAAACTCCTCCTGATAACGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019960
HSPB3 MISSION shRNA Lentiviral Transduction Particles
heat shock 27kDa protein 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-528s1c1
Sequence:CCGGCAGTACAAACTGCCAGATGGACTCGAGTCCATCTGGCAGTTTGTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-549s1c1
Sequence:CCGGGTCGAAACCAAAGATTTGTCTCTCGAGAGACAAATCTTTGGTTTCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-575s1c1
Sequence:CCGGCCTCTGTCATGATGGAATCTTCTCGAGAAGATTCCATCATGACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-515s1c1
Sequence:CCGGGAGTTTCACCAGACAGTACAACTCGAGTTGTACTGTCTGGTGAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-487s1c1
Sequence:CCGGGAATGGACGAACACGGGTTTACTCGAGTAAACCCGTGTTCGTCCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-608s1c1
Sequence:CCGGCAAAGATTCACTAGGGACCAACTCGAGTTGGTCCCTAGTGAATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019960.1-207s1c1
Sequence:CCGGGTGCGTTATCAGGAGGAGTTTCTCGAGAAACTCCTCCTGATAACGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)