EMAIL THIS PAGE TO A FRIEND

HSPB6

heat shock protein, alpha-crystallin-related, B6

53 Gene Product Result for
Synonyms: Hsp20
UniProtKB ID: O14558, O14551, Q6NVI3, Q96MG9
Gene ID:
Human(126393) Summary: This locus encodes a heat shock protein. The encoded protein likely plays a role in smooth muscle relaxation. [provided by RefSeq, Jan 2012]
Mouse(243912) heat shock protein, alpha-crystallin-related, B6
Rat(192245) heat shock protein, alpha-crystallin-related, B6
sheep(101104335) heat shock protein, alpha-crystallin-related, B6
domestic guinea pig(100724640) heat shock protein, alpha-crystallin-related, B6
naked mole-rat(101701779) heat shock protein, alpha-crystallin-related, B6
Zebrafish(792610) heat shock protein, alpha-crystallin-related, b6
cow(534551) heat shock protein, alpha-crystallin-related, B6
domestic cat(101098270) heat shock protein, alpha-crystallin-related, B6
dog(484574) heat shock protein, alpha-crystallin-related, B6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144617 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001012401 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001012401 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001012401 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144617 Rosetta Predictions human pricing
NM_138887 Rosetta Predictions rat pricing
NM_001012401 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133459 predicted 256
2 SASI_Hs01_00133460 predicted 643
3 SASI_Hs01_00133461 predicted 646
4 SASI_Hs01_00133468 predicted 566
5 SASI_Hs01_00133462 predicted 529
6 SASI_Hs01_00133463 predicted 728
7 SASI_Hs01_00133464 predicted 360
8 SASI_Hs01_00133465 predicted 265
9 SASI_Hs01_00133466 predicted 719
10 SASI_Hs02_00364439 predicted 272
11 SASI_Hs01_00133467 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068277 predicted 264
2 SASI_Rn01_00068278 predicted 257
3 SASI_Rn01_00068280 predicted 721
4 SASI_Rn01_00068281 predicted 709
5 SASI_Rn01_00068282 predicted 838
6 SASI_Rn01_00068283 predicted 647
7 SASI_Rn01_00068284 predicted 566
8 SASI_Rn01_00068285 predicted 960
9 SASI_Rn01_00068286 predicted 789
10 SASI_Rn02_00268322 predicted 905
11 SASI_Rn01_00068279 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012401 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088893 predicted 352
2 SASI_Mm01_00088894 predicted 897
3 SASI_Mm01_00088895 predicted 599
4 SASI_Mm01_00088896 predicted 823
5 SASI_Mm01_00088897 predicted 293
6 SASI_Mm01_00088898 predicted 775
7 SASI_Mm02_00287107 predicted 771
8 SASI_Mm01_00088899 predicted 539
9 SASI_Mm01_00088900 predicted 841
10 SASI_Mm01_00088901 predicted 742
11 SASI_Mm01_00088902 predicted 891
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144617
HSPB6 MISSION shRNA Bacterial Glycerol Stock
heat shock protein, alpha-crystallin-related, B6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144617.1-651s21c1
Sequence:CCGGGACACTGCCTTGATAACATAGCTCGAGCTATGTTATCAAGGCAGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144617.1-539s21c1
Sequence:CCGGTCCTCAGGCTCCCTCTATTAACTCGAGTTAATAGAGGGAGCCTGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144617.1-265s21c1
Sequence:CCGGCACTTCTCGCCGGAGGAAATTCTCGAGAATTTCCTCCGGCGAGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144617.1-1043s1c1
Sequence:CCGGCTGCAACCAGACAGTCTACAACTCGAGTTGTAGACTGTCTGGTTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144617.1-280s1c1
Sequence:CCGGGAAATTGCTGTCAAGGTGGTGCTCGAGCACCACCTTGACAGCAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144617.1-277s1c1
Sequence:CCGGGAGGAAATTGCTGTCAAGGTGCTCGAGCACCTTGACAGCAATTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144617.1-879s1c1
Sequence:CCGGCATTTCCATCCCTTCCCTATTCTCGAGAATAGGGAAGGGATGGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144617.1-848s1c1
Sequence:CCGGCTGAGTCCTCTACAAAGACATCTCGAGATGTCTTTGTAGAGGACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144617
HSPB6 MISSION shRNA shRNA Plasmid DNA
heat shock protein, alpha-crystallin-related, B6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144617.1-651s21c1
Sequence:CCGGGACACTGCCTTGATAACATAGCTCGAGCTATGTTATCAAGGCAGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144617.1-539s21c1
Sequence:CCGGTCCTCAGGCTCCCTCTATTAACTCGAGTTAATAGAGGGAGCCTGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144617.1-265s21c1
Sequence:CCGGCACTTCTCGCCGGAGGAAATTCTCGAGAATTTCCTCCGGCGAGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144617.1-1043s1c1
Sequence:CCGGCTGCAACCAGACAGTCTACAACTCGAGTTGTAGACTGTCTGGTTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144617.1-280s1c1
Sequence:CCGGGAAATTGCTGTCAAGGTGGTGCTCGAGCACCACCTTGACAGCAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144617.1-277s1c1
Sequence:CCGGGAGGAAATTGCTGTCAAGGTGCTCGAGCACCTTGACAGCAATTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144617.1-879s1c1
Sequence:CCGGCATTTCCATCCCTTCCCTATTCTCGAGAATAGGGAAGGGATGGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144617.1-848s1c1
Sequence:CCGGCTGAGTCCTCTACAAAGACATCTCGAGATGTCTTTGTAGAGGACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144617
HSPB6 MISSION shRNA Lentiviral Transduction Particles
heat shock protein, alpha-crystallin-related, B6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144617.1-651s21c1
Sequence:CCGGGACACTGCCTTGATAACATAGCTCGAGCTATGTTATCAAGGCAGTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144617.1-539s21c1
Sequence:CCGGTCCTCAGGCTCCCTCTATTAACTCGAGTTAATAGAGGGAGCCTGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144617.1-265s21c1
Sequence:CCGGCACTTCTCGCCGGAGGAAATTCTCGAGAATTTCCTCCGGCGAGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157966    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144617.1-1043s1c1
Sequence:CCGGCTGCAACCAGACAGTCTACAACTCGAGTTGTAGACTGTCTGGTTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144617.1-280s1c1
Sequence:CCGGGAAATTGCTGTCAAGGTGGTGCTCGAGCACCACCTTGACAGCAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144617.1-277s1c1
Sequence:CCGGGAGGAAATTGCTGTCAAGGTGCTCGAGCACCTTGACAGCAATTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144617.1-879s1c1
Sequence:CCGGCATTTCCATCCCTTCCCTATTCTCGAGAATAGGGAAGGGATGGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155907    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144617.1-848s1c1
Sequence:CCGGCTGAGTCCTCTACAAAGACATCTCGAGATGTCTTTGTAGAGGACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012401
HSPB6 MISSION shRNA Bacterial Glycerol Stock
heat shock protein, alpha-crystallin-related, B6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000112235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012401.1-1008s1c1
Sequence:CCGGCCAGCCCACTTTCAGACTTAACTCGAGTTAAGTCTGAAAGTGGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012401.1-353s1c1
Sequence:CCGGCCGGATGAACACGGATTCATTCTCGAGAATGAATCCGTGTTCATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012401.1-277s1c1
Sequence:CCGGGCACTTCTTGCCAGAGGAAATCTCGAGATTTCCTCTGGCAAGAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012401.1-364s1c1
Sequence:CCGGCGGATTCATTGCTCGAGAGTTCTCGAGAACTCTCGAGCAATGAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012401
HSPB6 MISSION shRNA shRNA Plasmid DNA
heat shock protein, alpha-crystallin-related, B6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000112235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012401.1-1008s1c1
Sequence:CCGGCCAGCCCACTTTCAGACTTAACTCGAGTTAAGTCTGAAAGTGGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012401.1-353s1c1
Sequence:CCGGCCGGATGAACACGGATTCATTCTCGAGAATGAATCCGTGTTCATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012401.1-277s1c1
Sequence:CCGGGCACTTCTTGCCAGAGGAAATCTCGAGATTTCCTCTGGCAAGAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012401.1-364s1c1
Sequence:CCGGCGGATTCATTGCTCGAGAGTTCTCGAGAACTCTCGAGCAATGAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012401
HSPB6 MISSION shRNA Lentiviral Transduction Particles
heat shock protein, alpha-crystallin-related, B6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000112235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012401.1-1008s1c1
Sequence:CCGGCCAGCCCACTTTCAGACTTAACTCGAGTTAAGTCTGAAAGTGGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012401.1-353s1c1
Sequence:CCGGCCGGATGAACACGGATTCATTCTCGAGAATGAATCCGTGTTCATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012401.1-277s1c1
Sequence:CCGGGCACTTCTTGCCAGAGGAAATCTCGAGATTTCCTCTGGCAAGAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012401.1-364s1c1
Sequence:CCGGCGGATTCATTGCTCGAGAGTTCTCGAGAACTCTCGAGCAATGAATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)