EMAIL THIS PAGE TO A FRIEND

HSPB8

heat shock 22kDa protein 8

128 Gene Product Result for
Synonyms: CMT2L DHMN2 E2IG1 H11 HMN2 HMN2A HSP22
UniProtKB ID: Q9UJY1, B2R6A6, Q6FIH3, Q9UKS3
Gene ID:
Human(26353) Summary: The protein encoded by this gene belongs to the superfamily of small heat-shock proteins containing a conservative alpha-crystallin domain at the C-terminal part of the molecule. The expression of this gene in induced by estrogen in estrogen receptor-positive breast cancer cells, and this protein also functions as a chaperone in association with Bag3, a stimulator of macroautophagy. Thus, this gene appears to be involved in regulation of cell proliferation, apoptosis, and carcinogenesis, and mutations in this gene have been associated with different neuromuscular diseases, including Charcot-Marie-Tooth disease. [provided by RefSeq, Jul 2008]
Mouse(80888) heat shock protein 8
Rat(113906) heat shock protein B8
sheep(101108164) heat shock 22kDa protein 8
domestic guinea pig(100734199) heat shock 22kDa protein 8
naked mole-rat(101707078) heat shock 22kDa protein 8
Zebrafish(791580) heat shock protein, alpha-crystallin-related, b8
dog(403553) heat shock 22kDa protein 8
cow(539524) heat shock 22kDa protein 8
domestic cat(101093804) heat shock 22kDa protein 8
chicken(416988) heat shock 22kDa protein 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014365 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014365 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014365 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014365 siRNAs that have been validated in the lab human pricing
NM_053612 Rosetta Predictions rat pricing
NM_030704 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014365 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050175 validated 1408
1 SASI_Hs01_00050174 validated 925
1 SASI_Hs01_00050176 validated 1595
2 SASI_Hs01_00050177 predicted 1530
3 SASI_Hs02_00345515 predicted 844
4 SASI_Hs01_00050178 predicted 1299
5 SASI_Hs01_00050179 predicted 1263
6 SASI_Hs01_00050180 predicted 1242
7 SASI_Hs01_00050181 predicted 1413
8 SASI_Hs01_00050182 predicted 1171
9 SASI_Hs01_00050183 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048001 predicted 1148
2 SASI_Rn01_00048002 predicted 811
3 SASI_Rn01_00048003 predicted 1425
4 SASI_Rn01_00048004 predicted 1000
5 SASI_Rn01_00048005 predicted 636
6 SASI_Rn01_00048006 predicted 1392
7 SASI_Rn01_00048007 predicted 1401
8 SASI_Rn01_00048008 predicted 1336
9 SASI_Rn01_00048009 predicted 1395
10 SASI_Rn01_00048010 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148518 predicted 680
2 SASI_Mm02_00336876 predicted 1166
3 SASI_Mm02_00336877 predicted 1058
4 SASI_Mm01_00148522 predicted 736
5 SASI_Mm02_00336878 predicted 1052
6 SASI_Mm02_00336879 predicted 689
7 SASI_Mm02_00336880 predicted 573
8 SASI_Mm01_00148525 predicted 1179
9 SASI_Mm02_00336881 predicted 708
10 SASI_Mm02_00336882 predicted 1262
11 SASI_Mm01_00148517 predicted 1366
12 SASI_Mm01_00148519 predicted 838
13 SASI_Mm01_00148520 predicted 1461
14 SASI_Mm01_00148521 predicted 1384
15 SASI_Mm01_00148523 predicted 1293
16 SASI_Mm01_00148524 predicted 1025
17 SASI_Mm01_00148526 predicted 1437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014365
VALIDATED
HSPB8 MISSION shRNA Bacterial Glycerol Stock
heat shock 22kDa protein 8
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-1004s21c1
Sequence:CCGGGAGGGTCTGCTGATCATCGAACTCGAGTTCGATGATCAGCAGACCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-807s21c1
Sequence:CCGGCCTGGAAAGTGTGTGTGAATGCTCGAGCATTCACACACACTTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-921s21c1
Sequence:CCGGGCATTGTTTCTAAGAACTTCACTCGAGTGAAGTTCTTAGAAACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-1033s21c1
Sequence:CCGGGGTCCCTCCTTACTCAACATTCTCGAGAATGTTGAGTAAGGAGGGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014365.2-865s1c1
Sequence:CCGGCAAAGATGGATACGTGGAGGTCTCGAGACCTCCACGTATCCATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014365.2-609s1c1
Sequence:CCGGGCCTGCTGGATGATGGCTTTGCTCGAGCAAAGCCATCATCCAGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-1530s1c1
Sequence:CCGGCCGCATGGTTTGGTTAATGAACTCGAGTTCATTAACCAAACCATGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-1258s1c1
Sequence:CCGGGATAGTGTAGTGGTAGATTTCCTCGAGGAAATCTACCACTACACTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-655s1c1
Sequence:CCGGGACAGCCTCTTGGCCCGACTGCTCGAGCAGTCGGGCCAAGAGGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014365.2-979s1c1
Sequence:CCGGGACAGTATTTGCCTCACTTTCCTCGAGGAAAGTGAGGCAAATACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-921s1c1
Sequence:CCGGGCATTGTTTCTAAGAACTTCACTCGAGTGAAGTTCTTAGAAACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014365.2-1004s1c1
Sequence:CCGGGAGGGTCTGCTGATCATCGAACTCGAGTTCGATGATCAGCAGACCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014365.x-638s1c1
Sequence:CCGGCCCTTCCCAGACGACTTGACACTCGAGTGTCAAGTCGTCTGGGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014365.x-807s1c1
Sequence:CCGGCCTGGAAAGTGTGTGTGAATGCTCGAGCATTCACACACACTTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014365.x-1033s1c1
Sequence:CCGGGGTCCCTCCTTACTCAACATTCTCGAGAATGTTGAGTAAGGAGGGACCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014365
VALIDATED
HSPB8 MISSION shRNA shRNA Plasmid DNA
heat shock 22kDa protein 8
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-1004s21c1
Sequence:CCGGGAGGGTCTGCTGATCATCGAACTCGAGTTCGATGATCAGCAGACCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-807s21c1
Sequence:CCGGCCTGGAAAGTGTGTGTGAATGCTCGAGCATTCACACACACTTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-921s21c1
Sequence:CCGGGCATTGTTTCTAAGAACTTCACTCGAGTGAAGTTCTTAGAAACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-1033s21c1
Sequence:CCGGGGTCCCTCCTTACTCAACATTCTCGAGAATGTTGAGTAAGGAGGGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014365.2-865s1c1
Sequence:CCGGCAAAGATGGATACGTGGAGGTCTCGAGACCTCCACGTATCCATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014365.2-609s1c1
Sequence:CCGGGCCTGCTGGATGATGGCTTTGCTCGAGCAAAGCCATCATCCAGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-1530s1c1
Sequence:CCGGCCGCATGGTTTGGTTAATGAACTCGAGTTCATTAACCAAACCATGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-1258s1c1
Sequence:CCGGGATAGTGTAGTGGTAGATTTCCTCGAGGAAATCTACCACTACACTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-655s1c1
Sequence:CCGGGACAGCCTCTTGGCCCGACTGCTCGAGCAGTCGGGCCAAGAGGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014365.2-979s1c1
Sequence:CCGGGACAGTATTTGCCTCACTTTCCTCGAGGAAAGTGAGGCAAATACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-921s1c1
Sequence:CCGGGCATTGTTTCTAAGAACTTCACTCGAGTGAAGTTCTTAGAAACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014365.2-1004s1c1
Sequence:CCGGGAGGGTCTGCTGATCATCGAACTCGAGTTCGATGATCAGCAGACCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014365.x-638s1c1
Sequence:CCGGCCCTTCCCAGACGACTTGACACTCGAGTGTCAAGTCGTCTGGGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014365.x-807s1c1
Sequence:CCGGCCTGGAAAGTGTGTGTGAATGCTCGAGCATTCACACACACTTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014365.x-1033s1c1
Sequence:CCGGGGTCCCTCCTTACTCAACATTCTCGAGAATGTTGAGTAAGGAGGGACCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014365
VALIDATED
HSPB8 MISSION shRNA Lentiviral Transduction Particles
heat shock 22kDa protein 8
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-1004s21c1
Sequence:CCGGGAGGGTCTGCTGATCATCGAACTCGAGTTCGATGATCAGCAGACCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-807s21c1
Sequence:CCGGCCTGGAAAGTGTGTGTGAATGCTCGAGCATTCACACACACTTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-921s21c1
Sequence:CCGGGCATTGTTTCTAAGAACTTCACTCGAGTGAAGTTCTTAGAAACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014365.2-1033s21c1
Sequence:CCGGGGTCCCTCCTTACTCAACATTCTCGAGAATGTTGAGTAAGGAGGGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014365.2-865s1c1
Sequence:CCGGCAAAGATGGATACGTGGAGGTCTCGAGACCTCCACGTATCCATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014365.2-609s1c1
Sequence:CCGGGCCTGCTGGATGATGGCTTTGCTCGAGCAAAGCCATCATCCAGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-1530s1c1
Sequence:CCGGCCGCATGGTTTGGTTAATGAACTCGAGTTCATTAACCAAACCATGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196245    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-1258s1c1
Sequence:CCGGGATAGTGTAGTGGTAGATTTCCTCGAGGAAATCTACCACTACACTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-655s1c1
Sequence:CCGGGACAGCCTCTTGGCCCGACTGCTCGAGCAGTCGGGCCAAGAGGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014365.2-979s1c1
Sequence:CCGGGACAGTATTTGCCTCACTTTCCTCGAGGAAAGTGAGGCAAATACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014365.2-921s1c1
Sequence:CCGGGCATTGTTTCTAAGAACTTCACTCGAGTGAAGTTCTTAGAAACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014365.2-1004s1c1
Sequence:CCGGGAGGGTCTGCTGATCATCGAACTCGAGTTCGATGATCAGCAGACCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_014365.x-638s1c1
Sequence:CCGGCCCTTCCCAGACGACTTGACACTCGAGTGTCAAGTCGTCTGGGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014365.x-807s1c1
Sequence:CCGGCCTGGAAAGTGTGTGTGAATGCTCGAGCATTCACACACACTTTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014365.x-1033s1c1
Sequence:CCGGGGTCCCTCCTTACTCAACATTCTCGAGAATGTTGAGTAAGGAGGGACCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030704
VALIDATED
HSPB8 MISSION shRNA Bacterial Glycerol Stock
heat shock 22kDa protein 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030704.2-1373s21c1
Sequence:CCGGGCTTGGTTGATGGGACTCATTCTCGAGAATGAGTCCCATCAACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030704.2-781s21c1
Sequence:CCGGTGGGATTGTCTCCAAGAACTTCTCGAGAAGTTCTTGGAGACAATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030704.2-740s21c1
Sequence:CCGGGTGGAAGTTTCAGGCAAACATCTCGAGATGTTTGCCTGAAACTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030704.2-667s21c1
Sequence:CCGGGCCTTGGAAAGTGTGTGTCAACTCGAGTTGACACACACTTTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-1373s1c1
Sequence:CCGGGCTTGGTTGATGGGACTCATTCTCGAGAATGAGTCCCATCAACCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030704.1-781s1c1
Sequence:CCGGTGGGATTGTCTCCAAGAACTTCTCGAGAAGTTCTTGGAGACAATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-740s1c1
Sequence:CCGGGTGGAAGTTTCAGGCAAACATCTCGAGATGTTTGCCTGAAACTTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-667s1c1
Sequence:CCGGGCCTTGGAAAGTGTGTGTCAACTCGAGTTGACACACACTTTCCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-840s1c1
Sequence:CCGGCCACTGTATTTGCCTCGCTTTCTCGAGAAAGCGAGGCAAATACAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030704
VALIDATED
HSPB8 MISSION shRNA shRNA Plasmid DNA
heat shock 22kDa protein 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030704.2-1373s21c1
Sequence:CCGGGCTTGGTTGATGGGACTCATTCTCGAGAATGAGTCCCATCAACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030704.2-781s21c1
Sequence:CCGGTGGGATTGTCTCCAAGAACTTCTCGAGAAGTTCTTGGAGACAATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030704.2-740s21c1
Sequence:CCGGGTGGAAGTTTCAGGCAAACATCTCGAGATGTTTGCCTGAAACTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030704.2-667s21c1
Sequence:CCGGGCCTTGGAAAGTGTGTGTCAACTCGAGTTGACACACACTTTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-1373s1c1
Sequence:CCGGGCTTGGTTGATGGGACTCATTCTCGAGAATGAGTCCCATCAACCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030704.1-781s1c1
Sequence:CCGGTGGGATTGTCTCCAAGAACTTCTCGAGAAGTTCTTGGAGACAATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-740s1c1
Sequence:CCGGGTGGAAGTTTCAGGCAAACATCTCGAGATGTTTGCCTGAAACTTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-667s1c1
Sequence:CCGGGCCTTGGAAAGTGTGTGTCAACTCGAGTTGACACACACTTTCCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-840s1c1
Sequence:CCGGCCACTGTATTTGCCTCGCTTTCTCGAGAAAGCGAGGCAAATACAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030704
VALIDATED
HSPB8 MISSION shRNA Lentiviral Transduction Particles
heat shock 22kDa protein 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030704.2-1373s21c1
Sequence:CCGGGCTTGGTTGATGGGACTCATTCTCGAGAATGAGTCCCATCAACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030704.2-781s21c1
Sequence:CCGGTGGGATTGTCTCCAAGAACTTCTCGAGAAGTTCTTGGAGACAATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030704.2-740s21c1
Sequence:CCGGGTGGAAGTTTCAGGCAAACATCTCGAGATGTTTGCCTGAAACTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030704.2-667s21c1
Sequence:CCGGGCCTTGGAAAGTGTGTGTCAACTCGAGTTGACACACACTTTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-1373s1c1
Sequence:CCGGGCTTGGTTGATGGGACTCATTCTCGAGAATGAGTCCCATCAACCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030704.1-781s1c1
Sequence:CCGGTGGGATTGTCTCCAAGAACTTCTCGAGAAGTTCTTGGAGACAATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-740s1c1
Sequence:CCGGGTGGAAGTTTCAGGCAAACATCTCGAGATGTTTGCCTGAAACTTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-667s1c1
Sequence:CCGGGCCTTGGAAAGTGTGTGTCAACTCGAGTTGACACACACTTTCCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030704.1-840s1c1
Sequence:CCGGCCACTGTATTTGCCTCGCTTTCTCGAGAAAGCGAGGCAAATACAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)