EMAIL THIS PAGE TO A FRIEND

HSPB9

heat shock protein, alpha-crystallin-related, B9

60 Gene Product Result for
Synonyms: CT51
UniProtKB ID: Q9BQS6, B3KSG6, Q52LB4
Gene ID:
Mouse(75482) heat shock protein, alpha-crystallin-related, B9
Rat(363681) heat shock protein, alpha-crystallin-related, B9
Zebrafish(100137108) heat shock protein, alpha-crystallin-related, 9
cow(614199) heat shock protein, alpha-crystallin-related, B9
domestic cat(101090407) heat shock protein, alpha-crystallin-related, B9
dog(490970) heat shock protein, alpha-crystallin-related, B9
domestic guinea pig(100716812) heat shock protein, alpha-crystallin-related, B9
naked mole-rat(101724498) heat shock protein, alpha-crystallin-related, B9
sheep(101121786) heat shock protein, alpha-crystallin-related, B9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033194 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU188241 MISSION® esiRNA esiRNA targeting mouse Hspb9 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033194 Rosetta Predictions human pricing
NM_001108835 Rosetta Predictions rat pricing
XM_894891 Rosetta Predictions mouse pricing
XM_905113 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166174 predicted 222
2 SASI_Hs01_00166175 predicted 249
3 SASI_Hs01_00166176 predicted 273
4 SASI_Hs01_00166177 predicted 328
5 SASI_Hs01_00166178 predicted 286
6 SASI_Hs01_00166179 predicted 35
7 SASI_Hs01_00166180 predicted 144
8 SASI_Hs01_00166181 predicted 312
9 SASI_Hs01_00166182 predicted 142
10 SASI_Hs02_00360981 predicted 7
11 SASI_Hs01_00166183 predicted 122
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242545 predicted 358
2 SASI_Rn02_00242546 predicted 355
3 SASI_Rn02_00242547 predicted 245
4 SASI_Rn02_00242548 predicted 325
5 SASI_Rn02_00242549 predicted 237
6 SASI_Rn02_00242550 predicted 309
7 SASI_Rn02_00242551 predicted 253
8 SASI_Rn02_00242552 predicted 267
9 SASI_Rn02_00242553 predicted 213
10 SASI_Rn02_00242554 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894891 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00429571 predicted 262
2 SASI_Mm01_00243848 predicted 240
3 SASI_Mm01_00243853 predicted 311
4 SASI_Mm01_00243854 predicted 238
5 SASI_Mm02_00429572 predicted 223
6 SASI_Mm02_00429573 predicted 219
7 SASI_Mm02_00429574 predicted 252
8 SASI_Mm02_00429575 predicted 316
9 SASI_Mm02_00429576 predicted 235
10 SASI_Mm02_00429577 predicted 205
11 SASI_Mm01_00243846 predicted 227
12 SASI_Mm01_00243847 predicted 388
13 SASI_Mm01_00243849 predicted 245
14 SASI_Mm01_00243850 predicted 423
15 SASI_Mm01_00243851 predicted 249
16 SASI_Mm01_00243852 predicted 343
17 SASI_Mm01_00243855 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905113 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431503 predicted 261
2 SASI_Mm02_00431504 predicted 240
3 SASI_Mm02_00431505 predicted 315
4 SASI_Mm02_00431506 predicted 239
5 SASI_Mm02_00431507 predicted 224
6 SASI_Mm02_00431508 predicted 211
7 SASI_Mm02_00431509 predicted 255
8 SASI_Mm02_00431510 predicted 308
9 SASI_Mm02_00431511 predicted 228
10 SASI_Mm02_00431512 predicted 206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029307
HSPB9 MISSION shRNA Bacterial Glycerol Stock
heat shock protein, alpha-crystallin-related, B9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-175s21c1
Sequence:CCGGGCCCTTGCTGAACGGAATCAACTCGAGTTGATTCCGTTCAGCAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-98s21c1
Sequence:CCGGAGCGGGTAGGAAGCAGTTTCTCTCGAGAGAAACTGCTTCCTACCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-252s21c1
Sequence:CCGGGCAACCAAGTTTCCAAATAAACTCGAGTTTATTTGGAAACTTGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-556s21c1
Sequence:CCGGGGGCCTAAGAGCTCCTTACAACTCGAGTTGTAAGGAGCTCTTAGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-396s21c1
Sequence:CCGGGCAGAGTGTTCACCGACAAATCTCGAGATTTGTCGGTGAACACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029307
HSPB9 MISSION shRNA shRNA Plasmid DNA
heat shock protein, alpha-crystallin-related, B9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-175s21c1
Sequence:CCGGGCCCTTGCTGAACGGAATCAACTCGAGTTGATTCCGTTCAGCAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-98s21c1
Sequence:CCGGAGCGGGTAGGAAGCAGTTTCTCTCGAGAGAAACTGCTTCCTACCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-252s21c1
Sequence:CCGGGCAACCAAGTTTCCAAATAAACTCGAGTTTATTTGGAAACTTGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-556s21c1
Sequence:CCGGGGGCCTAAGAGCTCCTTACAACTCGAGTTGTAAGGAGCTCTTAGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000341298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-396s21c1
Sequence:CCGGGCAGAGTGTTCACCGACAAATCTCGAGATTTGTCGGTGAACACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029307
HSPB9 MISSION shRNA Lentiviral Transduction Particles
heat shock protein, alpha-crystallin-related, B9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-175s21c1
Sequence:CCGGGCCCTTGCTGAACGGAATCAACTCGAGTTGATTCCGTTCAGCAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-98s21c1
Sequence:CCGGAGCGGGTAGGAAGCAGTTTCTCTCGAGAGAAACTGCTTCCTACCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-252s21c1
Sequence:CCGGGCAACCAAGTTTCCAAATAAACTCGAGTTTATTTGGAAACTTGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-556s21c1
Sequence:CCGGGGGCCTAAGAGCTCCTTACAACTCGAGTTGTAAGGAGCTCTTAGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000341298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029307.1-396s21c1
Sequence:CCGGGCAGAGTGTTCACCGACAAATCTCGAGATTTGTCGGTGAACACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033194
HSPB9 MISSION shRNA Bacterial Glycerol Stock
heat shock protein, alpha-crystallin-related, B9
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-218s21c1
Sequence:CCGGATGGCCAATGGCTGATGGTGACTCGAGTCACCATCAGCCATTGGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-279s21c1
Sequence:CCGGCAGTTACCGCATGTCACAGAACTCGAGTTCTGTGACATGCGGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-136s21c1
Sequence:CCGGGACAATGACCATGCCAGAGACCTCGAGGTCTCTGGCATGGTCATTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-123s21c1
Sequence:CCGGAGCGGCTCAGGAGGACAATGACTCGAGTCATTGTCCTCCTGAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-150s21c1
Sequence:CCGGCAGAGACGGTTTCCAAATGAACTCGAGTTCATTTGGAAACCGTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033194
HSPB9 MISSION shRNA shRNA Plasmid DNA
heat shock protein, alpha-crystallin-related, B9
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-218s21c1
Sequence:CCGGATGGCCAATGGCTGATGGTGACTCGAGTCACCATCAGCCATTGGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-279s21c1
Sequence:CCGGCAGTTACCGCATGTCACAGAACTCGAGTTCTGTGACATGCGGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-136s21c1
Sequence:CCGGGACAATGACCATGCCAGAGACCTCGAGGTCTCTGGCATGGTCATTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-123s21c1
Sequence:CCGGAGCGGCTCAGGAGGACAATGACTCGAGTCATTGTCCTCCTGAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-150s21c1
Sequence:CCGGCAGAGACGGTTTCCAAATGAACTCGAGTTCATTTGGAAACCGTCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033194
HSPB9 MISSION shRNA Lentiviral Transduction Particles
heat shock protein, alpha-crystallin-related, B9
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-218s21c1
Sequence:CCGGATGGCCAATGGCTGATGGTGACTCGAGTCACCATCAGCCATTGGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-279s21c1
Sequence:CCGGCAGTTACCGCATGTCACAGAACTCGAGTTCTGTGACATGCGGTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-136s21c1
Sequence:CCGGGACAATGACCATGCCAGAGACCTCGAGGTCTCTGGCATGGTCATTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-123s21c1
Sequence:CCGGAGCGGCTCAGGAGGACAATGACTCGAGTCATTGTCCTCCTGAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033194.1-150s21c1
Sequence:CCGGCAGAGACGGTTTCCAAATGAACTCGAGTTCATTTGGAAACCGTCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)