EMAIL THIS PAGE TO A FRIEND

HSPBAP1

HSPB (heat shock 27kDa) associated protein 1

75 Gene Product Result for
Synonyms: PASS1
UniProtKB ID: Q96EW2, Q6P476, Q8N8J4, Q8NHH6, Q8WWF0
Gene ID:
Human(79663) Summary: This gene encodes a protein that binds to one of the small heat shock proteins, specifically hsp27. Hsp27 is involved with cell growth and differentiation. This encoded protein was found to be abnormally expressed in patients with intractable epilepsy, although how brain function is affected remains unknown. [provided by RefSeq, Sep 2011]
Mouse(66667) Hspb associated protein 1
Rat(171460) Hspb associated protein 1
sheep(101114835) HSPB (heat shock 27kDa) associated protein 1
Domestic Rabbit(100340001) HSPB (heat shock 27kDa) associated protein 1
domestic guinea pig(100716425) HSPB (heat shock 27kDa) associated protein 1
naked mole-rat(101699233) HSPB (heat shock 27kDa) associated protein 1
Zebrafish(445320) hspb associated protein 1
cow(513211) HSPB (heat shock 27kDa) associated protein 1
Horse(100070550) HSPB (heat shock 27kDa) associated protein 1
dog(478587) HSPB (heat shock 27kDa) associated protein 1
chicken(424245) HSPB (heat shock 27kDa) associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0445 AQUA Peptide LFGPDL[K] human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024610 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024610 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024610 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175111 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175111 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175111 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093781 MISSION® esiRNA esiRNA human HSPBAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024610 Rosetta Predictions human pricing
NM_134419 Rosetta Predictions rat pricing
NM_175111 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059854 predicted 1129
2 SASI_Hs01_00059855 predicted 375
3 SASI_Hs02_00356972 predicted 1310
4 SASI_Hs01_00059856 predicted 1078
5 SASI_Hs01_00059857 predicted 690
6 SASI_Hs01_00059858 predicted 785
7 SASI_Hs01_00059859 predicted 248
8 SASI_Hs02_00356973 predicted 973
9 SASI_Hs01_00059860 predicted 735
10 SASI_Hs01_00059861 predicted 900
11 SASI_Hs01_00059862 predicted 271
12 SASI_Hs01_00059863 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093313 predicted 378
2 SASI_Rn01_00093314 predicted 425
3 SASI_Rn02_00268026 predicted 416
4 SASI_Rn01_00093315 predicted 721
5 SASI_Rn01_00093316 predicted 597
6 SASI_Rn01_00093317 predicted 304
7 SASI_Rn01_00093319 predicted 688
8 SASI_Rn01_00093320 predicted 821
9 SASI_Rn01_00093321 predicted 331
10 SASI_Rn01_00093322 predicted 275
11 SASI_Rn01_00093318 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175111 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077508 predicted 430
2 SASI_Mm02_00345717 predicted 483
3 SASI_Mm01_00077509 predicted 752
4 SASI_Mm01_00077510 predicted 853
5 SASI_Mm01_00077511 predicted 1199
6 SASI_Mm01_00077512 predicted 445
7 SASI_Mm01_00077513 predicted 1303
8 SASI_Mm01_00077514 predicted 1230
9 SASI_Mm01_00077515 predicted 339
10 SASI_Mm01_00077516 predicted 1116
11 SASI_Mm01_00077517 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024610
VALIDATED
HSPBAP1 MISSION shRNA Bacterial Glycerol Stock
HSPB (heat shock 27kDa) associated protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1568s21c1
Sequence:CCGGTGATACAAGGAAGAAGTTTATCTCGAGATAAACTTCTTCCTTGTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024610.3-656s1c1
Sequence:CCGGCCTATGGTTGTAACTTGGTATCTCGAGATACCAAGTTACAACCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024610.3-598s1c1
Sequence:CCGGCAGGAAAGTACATTGTGGATTCTCGAGAATCCACAATGTACTTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024610.3-463s1c1
Sequence:CCGGCCATTTAGAGATTATGACCATCTCGAGATGGTCATAATCTCTAAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024610.3-329s1c1
Sequence:CCGGGCAAGCAGATACGATTCAGAACTCGAGTTCTGAATCGTATCTGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1079s21c1
Sequence:CCGCCAGTCAACTGTTGCTACTTAACTCGAGTTAAGTAGCAACAGTTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024610.4-1700s21c1
Sequence:CCGGGTATTTATCCTTACCGAATTACTCGAGTAATTCGGTAAGGATAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-785s21c1
Sequence:CCGGATGTTGTCAATCCTGATTTAACTCGAGTTAAATCAGGATTGACAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1480s21c1
Sequence:CCGGACTACGACTCCTCAAACATTCCTCGAGGAATGTTTGAGGAGTCGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-288s21c1
Sequence:CCGGACGACACTGGAATGCTAAATACTCGAGTATTTAGCATTCCAGTGTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1456s21c1
Sequence:CCGGGAGGAACAGATTGCCTCAAATCTCGAGATTTGAGGCAATCTGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024610.3-1739s1c1
Sequence:CCGGCCTTCTTTCATGCACATTCCTCTCGAGAGGAATGTGCATGAAAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024610
VALIDATED
HSPBAP1 MISSION shRNA shRNA Plasmid DNA
HSPB (heat shock 27kDa) associated protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1568s21c1
Sequence:CCGGTGATACAAGGAAGAAGTTTATCTCGAGATAAACTTCTTCCTTGTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024610.3-656s1c1
Sequence:CCGGCCTATGGTTGTAACTTGGTATCTCGAGATACCAAGTTACAACCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024610.3-598s1c1
Sequence:CCGGCAGGAAAGTACATTGTGGATTCTCGAGAATCCACAATGTACTTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024610.3-463s1c1
Sequence:CCGGCCATTTAGAGATTATGACCATCTCGAGATGGTCATAATCTCTAAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024610.3-329s1c1
Sequence:CCGGGCAAGCAGATACGATTCAGAACTCGAGTTCTGAATCGTATCTGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1079s21c1
Sequence:CCGCCAGTCAACTGTTGCTACTTAACTCGAGTTAAGTAGCAACAGTTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024610.4-1700s21c1
Sequence:CCGGGTATTTATCCTTACCGAATTACTCGAGTAATTCGGTAAGGATAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-785s21c1
Sequence:CCGGATGTTGTCAATCCTGATTTAACTCGAGTTAAATCAGGATTGACAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1480s21c1
Sequence:CCGGACTACGACTCCTCAAACATTCCTCGAGGAATGTTTGAGGAGTCGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-288s21c1
Sequence:CCGGACGACACTGGAATGCTAAATACTCGAGTATTTAGCATTCCAGTGTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1456s21c1
Sequence:CCGGGAGGAACAGATTGCCTCAAATCTCGAGATTTGAGGCAATCTGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024610.3-1739s1c1
Sequence:CCGGCCTTCTTTCATGCACATTCCTCTCGAGAGGAATGTGCATGAAAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024610
VALIDATED
HSPBAP1 MISSION shRNA Lentiviral Transduction Particles
HSPB (heat shock 27kDa) associated protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1568s21c1
Sequence:CCGGTGATACAAGGAAGAAGTTTATCTCGAGATAAACTTCTTCCTTGTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_024610.3-656s1c1
Sequence:CCGGCCTATGGTTGTAACTTGGTATCTCGAGATACCAAGTTACAACCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024610.3-598s1c1
Sequence:CCGGCAGGAAAGTACATTGTGGATTCTCGAGAATCCACAATGTACTTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024610.3-463s1c1
Sequence:CCGGCCATTTAGAGATTATGACCATCTCGAGATGGTCATAATCTCTAAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024610.3-329s1c1
Sequence:CCGGGCAAGCAGATACGATTCAGAACTCGAGTTCTGAATCGTATCTGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1079s21c1
Sequence:CCGCCAGTCAACTGTTGCTACTTAACTCGAGTTAAGTAGCAACAGTTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024610.4-1700s21c1
Sequence:CCGGGTATTTATCCTTACCGAATTACTCGAGTAATTCGGTAAGGATAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-785s21c1
Sequence:CCGGATGTTGTCAATCCTGATTTAACTCGAGTTAAATCAGGATTGACAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1480s21c1
Sequence:CCGGACTACGACTCCTCAAACATTCCTCGAGGAATGTTTGAGGAGTCGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-288s21c1
Sequence:CCGGACGACACTGGAATGCTAAATACTCGAGTATTTAGCATTCCAGTGTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024610.4-1456s21c1
Sequence:CCGGGAGGAACAGATTGCCTCAAATCTCGAGATTTGAGGCAATCTGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_024610.3-1739s1c1
Sequence:CCGGCCTTCTTTCATGCACATTCCTCTCGAGAGGAATGTGCATGAAAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175111
VALIDATED
HSPBAP1 MISSION shRNA Bacterial Glycerol Stock
HSPB (heat shock 27kDa) associated protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000174971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175111.2-430s1c1
Sequence:CCGGGCTTACGCTGACTATAAGTATCTCGAGATACTTATAGTCAGCGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175111.2-650s1c1
Sequence:CCGGCTGAAGATACGCCTTTCCTTTCTCGAGAAAGGAAAGGCGTATCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175111.2-264s1c1
Sequence:CCGGCAAGCAGATACGGTTCAGAATCTCGAGATTCTGAACCGTATCTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175111.2-183s1c1
Sequence:CCGGGCCTGCAATCTTCTGTAACATCTCGAGATGTTACAGAAGATTGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175111
VALIDATED
HSPBAP1 MISSION shRNA shRNA Plasmid DNA
HSPB (heat shock 27kDa) associated protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000174971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175111.2-430s1c1
Sequence:CCGGGCTTACGCTGACTATAAGTATCTCGAGATACTTATAGTCAGCGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175111.2-650s1c1
Sequence:CCGGCTGAAGATACGCCTTTCCTTTCTCGAGAAAGGAAAGGCGTATCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175111.2-264s1c1
Sequence:CCGGCAAGCAGATACGGTTCAGAATCTCGAGATTCTGAACCGTATCTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175111.2-183s1c1
Sequence:CCGGGCCTGCAATCTTCTGTAACATCTCGAGATGTTACAGAAGATTGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175111
VALIDATED
HSPBAP1 MISSION shRNA Lentiviral Transduction Particles
HSPB (heat shock 27kDa) associated protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000174971    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175111.2-430s1c1
Sequence:CCGGGCTTACGCTGACTATAAGTATCTCGAGATACTTATAGTCAGCGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175111.2-650s1c1
Sequence:CCGGCTGAAGATACGCCTTTCCTTTCTCGAGAAAGGAAAGGCGTATCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175111.2-264s1c1
Sequence:CCGGCAAGCAGATACGGTTCAGAATCTCGAGATTCTGAACCGTATCTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175111.2-183s1c1
Sequence:CCGGGCCTGCAATCTTCTGTAACATCTCGAGATGTTACAGAAGATTGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)