EMAIL THIS PAGE TO A FRIEND

HSPD1

heat shock 60kDa protein 1 (chaperonin)

173 Gene Product Result for
Synonyms: CPN60 GROEL HLD4 HSP-60 HSP60 HSP65 HuCHA60 SPG13
UniProtKB ID: P10809, B2R5M6, Q38L19, Q9UCR6
Gene ID:
Human(3329) Summary: This gene encodes a member of the chaperonin family. The encoded mitochondrial protein may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. This gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Two transcript variants encoding the same protein have been identified for this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13. [provided by RefSeq, Jun 2010]
Mouse(15510) heat shock protein 1 (chaperonin)
Rat(63868) heat shock protein 1 (chaperonin)
Zebrafish(282676) heat shock 60kD protein 1 (chaperonin)
chicken(424059) heat shock 60kDa protein 1 (chaperonin)
cow(511913) heat shock 60kDa protein 1 (chaperonin)
Horse(100055147) heat shock 60kDa protein 1 (chaperonin)
domestic cat(101088683) heat shock 60kDa protein 1 (chaperonin)
dog(478854) heat shock 60kDa protein 1 (chaperonin)
Goat(100861238) heat shock 60kDa protein 1 (chaperonin)
Domestic Rabbit(100349912) heat shock 60kDa protein 1 (chaperonin)
sheep(101122254) heat shock 60kDa protein 1 (chaperonin)
domestic guinea pig(100715481) heat shock 60kDa protein 1 (chaperonin)
naked mole-rat(101706498) heat shock 60kDa protein 1 (chaperonin)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501464 Anti-HSP60, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1405973 Anti-HSPD1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2701717 Anti-hspd1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
HPA001523 Anti-HSPD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2107604 Anti-HSPD1 antibody produced in rabbit affinity isolated antibody guinea pig, rat, human, rabbit, horse, sheep
ELISA, western blot pricing
SAB1410668 Anti-HSPD1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA050025 Anti-HSPD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
H3524 Monoclonal Anti-Heat Shock Protein 60 antibody produced in mouse clone LK2, ascites fluid E. coli, helminth, spinach, chicken, human, rat
electron microscopy, ELISA, immunohistochemistry, western blot pricing
H4149 Monoclonal Anti-Heat Shock Protein 60 antibody produced in mouse clone LK1, ascites fluid rat, human, chicken
electron microscopy, ELISA, immunohistochemistry, western blot pricing
SAB4100596 Monoclonal Anti-HSPD1 antibody produced in mouse clone HSPD1-A580, culture supernatant human
western blot pricing
SAB4100597 Monoclonal Anti-HSPD1 antibody produced in mouse clone HSPD1-B580, culture supernatant human
western blot pricing
PLA0269 Rabbit anti-HSP60 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. guinea pig, mouse, dog, horse, primate, rat, bovine, rabbit, toad, human, pig, rhesus monkey
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002156 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002156 Rosetta Predictions human pricing
NM_199440 Rosetta Predictions human pricing
NM_022229 Rosetta Predictions rat pricing
XM_573677 Rosetta Predictions rat pricing
NM_010477 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136360 predicted 747
2 SASI_Hs01_00136363 predicted 1630
3 SASI_Hs02_00333353 predicted 1696
4 SASI_Hs01_00136364 predicted 782
5 SASI_Hs02_00333354 predicted 1683
6 SASI_Hs02_00333355 predicted 716
7 SASI_Hs02_00333356 predicted 1931
8 SASI_Hs01_00136368 predicted 652
9 SASI_Hs02_00333357 predicted 1827
10 SASI_Hs02_00333358 predicted 428
11 SASI_Hs01_00136361 predicted 1072
12 SASI_Hs01_00136362 predicted 1562
13 SASI_Hs01_00136365 predicted 1578
14 SASI_Hs01_00136366 predicted 1599
15 SASI_Hs01_00136367 predicted 1271
16 SASI_Hs01_00136369 predicted 1401
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372840 predicted 725
2 SASI_Hs02_00372841 predicted 1608
3 SASI_Hs02_00372842 predicted 1677
4 SASI_Hs02_00372843 predicted 765
5 SASI_Hs02_00372844 predicted 1660
6 SASI_Hs02_00372845 predicted 688
7 SASI_Hs02_00372846 predicted 1911
8 SASI_Hs02_00372847 predicted 625
9 SASI_Hs02_00372848 predicted 1809
10 SASI_Hs02_00372849 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022229 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091430 predicted 843
2 SASI_Rn02_00262993 predicted 1559
3 SASI_Rn01_00091431 predicted 248
4 SASI_Rn01_00091432 predicted 1428
5 SASI_Rn01_00091433 predicted 1379
6 SASI_Rn01_00091434 predicted 932
7 SASI_Rn01_00091435 predicted 1439
8 SASI_Rn01_00091436 predicted 1368
9 SASI_Rn02_00262994 predicted 1049
10 SASI_Rn01_00091437 predicted 1731
11 SASI_Rn01_00091438 predicted 1552
12 SASI_Rn01_00091439 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573677 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00186245 predicted 1184
2 SASI_Rn01_00186246 predicted 1182
3 SASI_Rn01_00186247 predicted 713
4 SASI_Rn01_00186248 predicted 876
5 SASI_Rn01_00186249 predicted 504
6 SASI_Rn01_00186250 predicted 812
7 SASI_Rn01_00186251 predicted 968
8 SASI_Rn01_00186252 predicted 1420
9 SASI_Rn01_00186253 predicted 1396
10 SASI_Rn01_00186254 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146427 predicted 1410
2 SASI_Mm01_00146428 predicted 1081
3 SASI_Mm01_00146422 predicted 995
4 SASI_Mm02_00318697 predicted 1160
5 SASI_Mm01_00146429 predicted 598
6 SASI_Mm02_00318698 predicted 433
7 SASI_Mm02_00318699 predicted 702
8 SASI_Mm01_00146424 predicted 332
9 SASI_Mm02_00318700 predicted 395
10 SASI_Mm02_00318701 predicted 877
11 SASI_Mm01_00146421 predicted 1805
12 SASI_Mm01_00146423 predicted 1804
13 SASI_Mm01_00146425 predicted 1818
14 SASI_Mm01_00146426 predicted 1867
15 SASI_Mm01_00146430 predicted 1441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002156
VALIDATED
HSPD1 MISSION shRNA Bacterial Glycerol Stock
heat shock 60kDa protein 1 (chaperonin)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-319s21c1
Sequence:CCGGCAGTGATTATTGAGCAGAGTTCTCGAGAACTCTGCTCAATAATCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-912s21c1
Sequence:CCGGCCTGCTCTTGAAATTGCCAATCTCGAGATTGGCAATTTCAAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-420s21c1
Sequence:CCGGGCTAAACTTGTTCAAGATGTTCTCGAGAACATCTTGAACAAGTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-1070s21c1
Sequence:CCGGCCAGCTTAAAGATATGGCTATCTCGAGATAGCCATATCTTTAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-1563s21c1
Sequence:CCGGGCAATGACCATTGCTAAGAATCTCGAGATTCTTAGCAATGGTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-1070s1c1
Sequence:CCGGCCAGCTTAAAGATATGGCTATCTCGAGATAGCCATATCTTTAAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002156.4-912s1c1
Sequence:CCGGCCTGCTCTTGAAATTGCCAATCTCGAGATTGGCAATTTCAAGAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-1563s1c1
Sequence:CCGGGCAATGACCATTGCTAAGAATCTCGAGATTCTTAGCAATGGTCATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-420s1c1
Sequence:CCGGGCTAAACTTGTTCAAGATGTTCTCGAGAACATCTTGAACAAGTTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-319s1c1
Sequence:CCGGCAGTGATTATTGAGCAGAGTTCTCGAGAACTCTGCTCAATAATCACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002156
VALIDATED
HSPD1 MISSION shRNA shRNA Plasmid DNA
heat shock 60kDa protein 1 (chaperonin)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-319s21c1
Sequence:CCGGCAGTGATTATTGAGCAGAGTTCTCGAGAACTCTGCTCAATAATCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-912s21c1
Sequence:CCGGCCTGCTCTTGAAATTGCCAATCTCGAGATTGGCAATTTCAAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-420s21c1
Sequence:CCGGGCTAAACTTGTTCAAGATGTTCTCGAGAACATCTTGAACAAGTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-1070s21c1
Sequence:CCGGCCAGCTTAAAGATATGGCTATCTCGAGATAGCCATATCTTTAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-1563s21c1
Sequence:CCGGGCAATGACCATTGCTAAGAATCTCGAGATTCTTAGCAATGGTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-1070s1c1
Sequence:CCGGCCAGCTTAAAGATATGGCTATCTCGAGATAGCCATATCTTTAAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002156.4-912s1c1
Sequence:CCGGCCTGCTCTTGAAATTGCCAATCTCGAGATTGGCAATTTCAAGAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-1563s1c1
Sequence:CCGGGCAATGACCATTGCTAAGAATCTCGAGATTCTTAGCAATGGTCATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-420s1c1
Sequence:CCGGGCTAAACTTGTTCAAGATGTTCTCGAGAACATCTTGAACAAGTTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-319s1c1
Sequence:CCGGCAGTGATTATTGAGCAGAGTTCTCGAGAACTCTGCTCAATAATCACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002156
VALIDATED
HSPD1 MISSION shRNA Lentiviral Transduction Particles
heat shock 60kDa protein 1 (chaperonin)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-319s21c1
Sequence:CCGGCAGTGATTATTGAGCAGAGTTCTCGAGAACTCTGCTCAATAATCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-912s21c1
Sequence:CCGGCCTGCTCTTGAAATTGCCAATCTCGAGATTGGCAATTTCAAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-420s21c1
Sequence:CCGGGCTAAACTTGTTCAAGATGTTCTCGAGAACATCTTGAACAAGTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-1070s21c1
Sequence:CCGGCCAGCTTAAAGATATGGCTATCTCGAGATAGCCATATCTTTAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002156.4-1563s21c1
Sequence:CCGGGCAATGACCATTGCTAAGAATCTCGAGATTCTTAGCAATGGTCATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-1070s1c1
Sequence:CCGGCCAGCTTAAAGATATGGCTATCTCGAGATAGCCATATCTTTAAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002156.4-912s1c1
Sequence:CCGGCCTGCTCTTGAAATTGCCAATCTCGAGATTGGCAATTTCAAGAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-1563s1c1
Sequence:CCGGGCAATGACCATTGCTAAGAATCTCGAGATTCTTAGCAATGGTCATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-420s1c1
Sequence:CCGGGCTAAACTTGTTCAAGATGTTCTCGAGAACATCTTGAACAAGTTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002156.4-319s1c1
Sequence:CCGGCAGTGATTATTGAGCAGAGTTCTCGAGAACTCTGCTCAATAATCACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010477
VALIDATED
HSPD1 MISSION shRNA Bacterial Glycerol Stock
heat shock 60kDa protein 1 (chaperonin)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010477.4-2061s21c1
Sequence:CCGGCCATGCCTACAGATAATTTATCTCGAGATAAATTATCTGTAGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010477.4-1781s21c1
Sequence:CCGGCCGAAGCTGTAGTGACAGAAACTCGAGTTTCTGTCACTACAGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010477.4-773s21c1
Sequence:CCGGCCCTGAATGATGAGCTAGAAACTCGAGTTTCTAGCTCATCATTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010477.4-1522s21c1
Sequence:CCGGCCTGCTAATGAAGACCAGAAACTCGAGTTTCTGGTCTTCATTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010477.2-1695s1c1
Sequence:CCGGCCGAAGCTGTAGTGACAGAAACTCGAGTTTCTGTCACTACAGCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010477.2-1436s1c1
Sequence:CCGGCCTGCTAATGAAGACCAGAAACTCGAGTTTCTGGTCTTCATTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010477.2-1435s1c1
Sequence:CCGGGCCTGCTAATGAAGACCAGAACTCGAGTTCTGGTCTTCATTAGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010477.2-687s1c1
Sequence:CCGGCCCTGAATGATGAGCTAGAAACTCGAGTTTCTAGCTCATCATTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010477.2-1975s1c1
Sequence:CCGGCCATGCCTACAGATAATTTATCTCGAGATAAATTATCTGTAGGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010477
VALIDATED
HSPD1 MISSION shRNA shRNA Plasmid DNA
heat shock 60kDa protein 1 (chaperonin)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010477.4-2061s21c1
Sequence:CCGGCCATGCCTACAGATAATTTATCTCGAGATAAATTATCTGTAGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010477.4-1781s21c1
Sequence:CCGGCCGAAGCTGTAGTGACAGAAACTCGAGTTTCTGTCACTACAGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010477.4-773s21c1
Sequence:CCGGCCCTGAATGATGAGCTAGAAACTCGAGTTTCTAGCTCATCATTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010477.4-1522s21c1
Sequence:CCGGCCTGCTAATGAAGACCAGAAACTCGAGTTTCTGGTCTTCATTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010477.2-1695s1c1
Sequence:CCGGCCGAAGCTGTAGTGACAGAAACTCGAGTTTCTGTCACTACAGCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010477.2-1436s1c1
Sequence:CCGGCCTGCTAATGAAGACCAGAAACTCGAGTTTCTGGTCTTCATTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010477.2-1435s1c1
Sequence:CCGGGCCTGCTAATGAAGACCAGAACTCGAGTTCTGGTCTTCATTAGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010477.2-687s1c1
Sequence:CCGGCCCTGAATGATGAGCTAGAAACTCGAGTTTCTAGCTCATCATTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010477.2-1975s1c1
Sequence:CCGGCCATGCCTACAGATAATTTATCTCGAGATAAATTATCTGTAGGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010477
VALIDATED
HSPD1 MISSION shRNA Lentiviral Transduction Particles
heat shock 60kDa protein 1 (chaperonin)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010477.4-2061s21c1
Sequence:CCGGCCATGCCTACAGATAATTTATCTCGAGATAAATTATCTGTAGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010477.4-1781s21c1
Sequence:CCGGCCGAAGCTGTAGTGACAGAAACTCGAGTTTCTGTCACTACAGCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010477.4-773s21c1
Sequence:CCGGCCCTGAATGATGAGCTAGAAACTCGAGTTTCTAGCTCATCATTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010477.4-1522s21c1
Sequence:CCGGCCTGCTAATGAAGACCAGAAACTCGAGTTTCTGGTCTTCATTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010477.2-1695s1c1
Sequence:CCGGCCGAAGCTGTAGTGACAGAAACTCGAGTTTCTGTCACTACAGCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010477.2-1436s1c1
Sequence:CCGGCCTGCTAATGAAGACCAGAAACTCGAGTTTCTGGTCTTCATTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010477.2-1435s1c1
Sequence:CCGGGCCTGCTAATGAAGACCAGAACTCGAGTTCTGGTCTTCATTAGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010477.2-687s1c1
Sequence:CCGGCCCTGAATGATGAGCTAGAAACTCGAGTTTCTAGCTCATCATTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112195    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010477.2-1975s1c1
Sequence:CCGGCCATGCCTACAGATAATTTATCTCGAGATAAATTATCTGTAGGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)