EMAIL THIS PAGE TO A FRIEND

HSPE1

heat shock 10kDa protein 1 (chaperonin 10)

63 Gene Product Result for
Synonyms: CPN10 EPF GROES HSP10
UniProtKB ID: P61604, O95421, Q04984, Q53X54, Q9UDH0
Gene ID:
Human(3336) Summary: This gene encodes a major heat shock protein which functions as a chaperonin. Its structure consists of a heptameric ring which binds to another heat shock protein in order to form a symmetric, functional heterodimer which enhances protein folding in an ATP-dependent manner. This gene and its co-chaperonin, HSPD1, are arranged in a head-to-head orientation on chromosome 2. Naturally occurring read-through transcription occurs between this locus and the neighboring locus MOBKL3.[provided by RefSeq, Feb 2011]
Mouse(15528) heat shock protein 1 (chaperonin 10)
Rat(25462) heat shock protein 1 (chaperonin 10)
Zebrafish(58041) heat shock 10 protein 1 (chaperonin 10)
dog(478855) heat shock 10kDa protein 1 (chaperonin 10)
chicken(395948) heat shock 10kDa protein 1 (chaperonin 10)
cow(281833) heat shock 10kDa protein 1 (chaperonin 10)
Goat(100861374) heat shock 10kDa protein 1 (chaperonin 10)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002157 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112631 MISSION® esiRNA esiRNA human HSPE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002157 Rosetta Predictions human pricing
NM_012966 Rosetta Predictions rat pricing
NM_008303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088324 predicted 297
2 SASI_Hs01_00088325 predicted 296
3 SASI_Hs01_00088328 predicted 282
4 SASI_Hs01_00088330 predicted 227
5 SASI_Hs01_00088331 predicted 278
6 SASI_Hs01_00088332 predicted 277
7 SASI_Hs01_00088333 predicted 204
8 SASI_Hs02_00333359 predicted 284
9 SASI_Hs02_00333360 predicted 202
10 SASI_Hs01_00088326 predicted 271
11 SASI_Hs01_00088327 predicted 273
12 SASI_Hs01_00088329 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012966 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042094 predicted 449
2 SASI_Rn01_00042095 predicted 288
3 SASI_Rn01_00042096 predicted 350
4 SASI_Rn01_00042097 predicted 444
5 SASI_Rn01_00042098 predicted 327
6 SASI_Rn01_00042099 predicted 293
7 SASI_Rn01_00042100 predicted 406
8 SASI_Rn01_00042101 predicted 399
9 SASI_Rn01_00042102 predicted 284
10 SASI_Rn01_00042103 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130014 predicted 436
2 SASI_Mm02_00313595 predicted 486
3 SASI_Mm02_00313596 predicted 288
4 SASI_Mm01_00130023 predicted 456
5 SASI_Mm02_00313597 predicted 320
6 SASI_Mm01_00130017 predicted 441
7 SASI_Mm02_00313598 predicted 297
8 SASI_Mm02_00313599 predicted 436
9 SASI_Mm02_00313600 predicted 513
10 SASI_Mm02_00313601 predicted 513
11 SASI_Mm01_00130015 predicted 286
12 SASI_Mm01_00130016 predicted 327
13 SASI_Mm01_00130018 predicted 302
14 SASI_Mm01_00130019 predicted 261
15 SASI_Mm01_00130020 predicted 327
16 SASI_Mm01_00130021 predicted 325
17 SASI_Mm01_00130022 predicted 339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008303
VALIDATED
HSPE1 MISSION shRNA Bacterial Glycerol Stock
heat shock 10kDa protein 1 (chaperonin 10)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008303.2-434s1c1
Sequence:CCGGGCCATTCCACTGATGTCTGAACTCGAGTTCAGACATCAGTGGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008303.2-121s1c1
Sequence:CCGGCTTCCGCTCTTTGACAGAGTACTCGAGTACTCTGTCAAAGAGCGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008303.2-281s1c1
Sequence:CCGGTCAGTGTGAAAGTTGGAGATACTCGAGTATCTCCAACTTTCACACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008303.2-179s1c1
Sequence:CCGGGTGGCATTATGCTTCCAGAAACTCGAGTTTCTGGAAGCATAATGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008303.2-298s1c1
Sequence:CCGGGATAAAGTTCTTCTCCCAGAACTCGAGTTCTGGGAGAAGAACTTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-348s21c1
Sequence:CCGGGTGGCATTATGCTTCCAGAAACTCGAGTTTCTGGAAGCATAATGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008303.4-603s21c1
Sequence:CCGGGCCATTCCACTGATGTCTGAACTCGAGTTCAGACATCAGTGGAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-467s21c1
Sequence:CCGGGATAAAGTTCTTCTCCCAGAACTCGAGTTCTGGGAGAAGAACTTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-450s21c1
Sequence:CCGGTCAGTGTGAAAGTTGGAGATACTCGAGTATCTCCAACTTTCACACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-290s21c1
Sequence:CCGGCTTCCGCTCTTTGACAGAGTACTCGAGTACTCTGTCAAAGAGCGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008303
VALIDATED
HSPE1 MISSION shRNA shRNA Plasmid DNA
heat shock 10kDa protein 1 (chaperonin 10)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008303.2-434s1c1
Sequence:CCGGGCCATTCCACTGATGTCTGAACTCGAGTTCAGACATCAGTGGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008303.2-121s1c1
Sequence:CCGGCTTCCGCTCTTTGACAGAGTACTCGAGTACTCTGTCAAAGAGCGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008303.2-281s1c1
Sequence:CCGGTCAGTGTGAAAGTTGGAGATACTCGAGTATCTCCAACTTTCACACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008303.2-179s1c1
Sequence:CCGGGTGGCATTATGCTTCCAGAAACTCGAGTTTCTGGAAGCATAATGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008303.2-298s1c1
Sequence:CCGGGATAAAGTTCTTCTCCCAGAACTCGAGTTCTGGGAGAAGAACTTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-348s21c1
Sequence:CCGGGTGGCATTATGCTTCCAGAAACTCGAGTTTCTGGAAGCATAATGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008303.4-603s21c1
Sequence:CCGGGCCATTCCACTGATGTCTGAACTCGAGTTCAGACATCAGTGGAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-467s21c1
Sequence:CCGGGATAAAGTTCTTCTCCCAGAACTCGAGTTCTGGGAGAAGAACTTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-450s21c1
Sequence:CCGGTCAGTGTGAAAGTTGGAGATACTCGAGTATCTCCAACTTTCACACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-290s21c1
Sequence:CCGGCTTCCGCTCTTTGACAGAGTACTCGAGTACTCTGTCAAAGAGCGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008303
VALIDATED
HSPE1 MISSION shRNA Lentiviral Transduction Particles
heat shock 10kDa protein 1 (chaperonin 10)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008303.2-434s1c1
Sequence:CCGGGCCATTCCACTGATGTCTGAACTCGAGTTCAGACATCAGTGGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008303.2-121s1c1
Sequence:CCGGCTTCCGCTCTTTGACAGAGTACTCGAGTACTCTGTCAAAGAGCGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008303.2-281s1c1
Sequence:CCGGTCAGTGTGAAAGTTGGAGATACTCGAGTATCTCCAACTTTCACACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008303.2-179s1c1
Sequence:CCGGGTGGCATTATGCTTCCAGAAACTCGAGTTTCTGGAAGCATAATGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008303.2-298s1c1
Sequence:CCGGGATAAAGTTCTTCTCCCAGAACTCGAGTTCTGGGAGAAGAACTTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-348s21c1
Sequence:CCGGGTGGCATTATGCTTCCAGAAACTCGAGTTTCTGGAAGCATAATGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008303.4-603s21c1
Sequence:CCGGGCCATTCCACTGATGTCTGAACTCGAGTTCAGACATCAGTGGAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-467s21c1
Sequence:CCGGGATAAAGTTCTTCTCCCAGAACTCGAGTTCTGGGAGAAGAACTTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-450s21c1
Sequence:CCGGTCAGTGTGAAAGTTGGAGATACTCGAGTATCTCCAACTTTCACACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008303.4-290s21c1
Sequence:CCGGCTTCCGCTCTTTGACAGAGTACTCGAGTACTCTGTCAAAGAGCGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002157
VALIDATED
HSPE1 MISSION shRNA Bacterial Glycerol Stock
heat shock 10kDa protein 1 (chaperonin 10)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-183s1c1
Sequence:CCGGGCTGTTGGATCGGGTTCTAAACTCGAGTTTAGAACCCGATCCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-168s1c1
Sequence:CCGGCAAGCAACAGTAGTCGCTGTTCTCGAGAACAGCGACTACTGTTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002157.1-230s1c1
Sequence:CCGGTAGCGTGAAAGTTGGAGATAACTCGAGTTATCTCCAACTTTCACGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-105s1c1
Sequence:CCGGGCTGCTGAAACTGTAACCAAACTCGAGTTTGGTTACAGTTTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-285s1c1
Sequence:CCGGGTTCTAGATGACAAGGATTATCTCGAGATAATCCTTGTCATCTAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-567s21c1
Sequence:CCGGCAAGCAACAGTAGTCGCTGTTCTCGAGAACAGCGACTACTGTTGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-684s21c1
Sequence:CCGGGTTCTAGATGACAAGGATTATCTCGAGATAATCCTTGTCATCTAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-504s21c1
Sequence:CCGGGCTGCTGAAACTGTAACCAAACTCGAGTTTGGTTACAGTTTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-629s21c1
Sequence:CCGGTAGCGTGAAAGTTGGAGATAACTCGAGTTATCTCCAACTTTCACGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-582s21c1
Sequence:CCGGGCTGTTGGATCGGGTTCTAAACTCGAGTTTAGAACCCGATCCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002157
VALIDATED
HSPE1 MISSION shRNA shRNA Plasmid DNA
heat shock 10kDa protein 1 (chaperonin 10)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-183s1c1
Sequence:CCGGGCTGTTGGATCGGGTTCTAAACTCGAGTTTAGAACCCGATCCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-168s1c1
Sequence:CCGGCAAGCAACAGTAGTCGCTGTTCTCGAGAACAGCGACTACTGTTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002157.1-230s1c1
Sequence:CCGGTAGCGTGAAAGTTGGAGATAACTCGAGTTATCTCCAACTTTCACGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-105s1c1
Sequence:CCGGGCTGCTGAAACTGTAACCAAACTCGAGTTTGGTTACAGTTTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-285s1c1
Sequence:CCGGGTTCTAGATGACAAGGATTATCTCGAGATAATCCTTGTCATCTAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-567s21c1
Sequence:CCGGCAAGCAACAGTAGTCGCTGTTCTCGAGAACAGCGACTACTGTTGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-684s21c1
Sequence:CCGGGTTCTAGATGACAAGGATTATCTCGAGATAATCCTTGTCATCTAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-504s21c1
Sequence:CCGGGCTGCTGAAACTGTAACCAAACTCGAGTTTGGTTACAGTTTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-629s21c1
Sequence:CCGGTAGCGTGAAAGTTGGAGATAACTCGAGTTATCTCCAACTTTCACGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-582s21c1
Sequence:CCGGGCTGTTGGATCGGGTTCTAAACTCGAGTTTAGAACCCGATCCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002157
VALIDATED
HSPE1 MISSION shRNA Lentiviral Transduction Particles
heat shock 10kDa protein 1 (chaperonin 10)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-183s1c1
Sequence:CCGGGCTGTTGGATCGGGTTCTAAACTCGAGTTTAGAACCCGATCCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-168s1c1
Sequence:CCGGCAAGCAACAGTAGTCGCTGTTCTCGAGAACAGCGACTACTGTTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002157.1-230s1c1
Sequence:CCGGTAGCGTGAAAGTTGGAGATAACTCGAGTTATCTCCAACTTTCACGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-105s1c1
Sequence:CCGGGCTGCTGAAACTGTAACCAAACTCGAGTTTGGTTACAGTTTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002157.1-285s1c1
Sequence:CCGGGTTCTAGATGACAAGGATTATCTCGAGATAATCCTTGTCATCTAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-567s21c1
Sequence:CCGGCAAGCAACAGTAGTCGCTGTTCTCGAGAACAGCGACTACTGTTGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-684s21c1
Sequence:CCGGGTTCTAGATGACAAGGATTATCTCGAGATAATCCTTGTCATCTAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-504s21c1
Sequence:CCGGGCTGCTGAAACTGTAACCAAACTCGAGTTTGGTTACAGTTTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-629s21c1
Sequence:CCGGTAGCGTGAAAGTTGGAGATAACTCGAGTTATCTCCAACTTTCACGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002157.2-582s21c1
Sequence:CCGGGCTGTTGGATCGGGTTCTAAACTCGAGTTTAGAACCCGATCCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)