EMAIL THIS PAGE TO A FRIEND

HSPH1

heat shock 105kDa/110kDa protein 1

125 Gene Product Result for
Synonyms: HSP105 HSP105A HSP105B NY-CO-25
UniProtKB ID: Q92598, O95739, Q5TBM6, Q5TBM7, Q5TBM8, Q9UPC4
Gene ID:
Mouse(15505) heat shock 105kDa/110kDa protein 1
Rat(288444) heat shock 105/110 protein 1
domestic guinea pig(100734848) heat shock 105kDa/110kDa protein 1
naked mole-rat(101702785) heat shock 105kDa/110kDa protein 1
sheep(101110772) heat shock 105kDa/110kDa protein 1
Domestic Rabbit(100352543) heat shock 105kDa/110kDa protein 1
chicken(418917) heat shock 105kDa/110kDa protein 1
domestic cat(101090575) heat shock 105kDa/110kDa protein 1
cow(507165) heat shock 105kDa/110kDa protein 1
Horse(100062150) heat shock 105kDa/110kDa protein 1
dog(477322) heat shock 105kDa/110kDa protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H7412 Anti-Heat Shock Protein 110 (EY-18) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
immunohistochemistry, microarray, western blot pricing
H7287 Anti-Heat Shock Protein 110 (HD-19) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat
immunohistochemistry, microarray, western blot pricing
SAB4500163 Anti-HSP105, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1101311 Anti-HSPH1 (731-745) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1300713 Anti-HSPH1 (C-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, western blot pricing
SAB1400405 Anti-HSPH1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2101104 Anti-HSPH1 antibody produced in rabbit affinity isolated antibody rat, pig, human, horse, guinea pig, bovine, mouse, rabbit
immunohistochemistry, western blot pricing
HPA028675 Anti-HSPH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106964 Anti-HSPH1 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, human, rat, horse
western blot pricing
HPA031569 Anti-HSPH1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006644 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006644 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006644 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006644 Rosetta Predictions human pricing
NM_001011901 Rosetta Predictions rat pricing
XM_573343 Rosetta Predictions rat pricing
NM_013559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006644 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234926 predicted 743
2 SASI_Hs01_00234927 predicted 1389
3 SASI_Hs01_00234928 predicted 1716
4 SASI_Hs01_00234929 predicted 1215
5 SASI_Hs01_00234931 predicted 1617
6 SASI_Hs01_00234932 predicted 2690
7 SASI_Hs02_00342008 predicted 924
8 SASI_Hs01_00234933 predicted 1478
9 SASI_Hs01_00234934 predicted 1600
10 SASI_Hs01_00234935 predicted 2785
11 SASI_Hs01_00234930 predicted 2774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095311 predicted 351
2 SASI_Rn02_00199889 predicted 326
3 SASI_Rn01_00095313 predicted 2256
4 SASI_Rn02_00199890 predicted 2469
5 SASI_Rn01_00095315 predicted 1333
6 SASI_Rn02_00199891 predicted 2113
7 SASI_Rn01_00095316 predicted 1351
8 SASI_Rn01_00095317 predicted 654
9 SASI_Rn01_00095319 predicted 2407
10 SASI_Rn01_00095320 predicted 1394
11 SASI_Rn01_00095312 predicted 2526
12 SASI_Rn01_00095314 predicted 1246
13 SASI_Rn01_00095318 predicted 2439
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00195443 predicted 2175
2 SASI_Rn01_00195444 predicted 904
3 SASI_Rn01_00195445 predicted 1905
4 SASI_Rn01_00195446 predicted 2121
5 SASI_Rn01_00195447 predicted 900
6 SASI_Rn01_00195448 predicted 978
7 SASI_Rn01_00195449 predicted 1773
8 SASI_Rn01_00195450 predicted 1001
9 SASI_Rn01_00195451 predicted 2078
10 SASI_Rn01_00195452 predicted 2056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119158 predicted 2163
2 SASI_Mm01_00119159 predicted 394
3 SASI_Mm01_00119160 predicted 2521
4 SASI_Mm01_00119161 predicted 2234
5 SASI_Mm01_00119162 predicted 1554
6 SASI_Mm01_00119163 predicted 1061
7 SASI_Mm01_00119164 predicted 2173
8 SASI_Mm02_00322286 predicted 1788
9 SASI_Mm01_00119165 predicted 1370
10 SASI_Mm02_00322287 predicted 2447
11 SASI_Mm01_00119166 predicted 2356
12 SASI_Mm01_00119167 predicted 2518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013559
VALIDATED
HSPH1 MISSION shRNA Bacterial Glycerol Stock
heat shock 105kDa/110kDa protein 1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013559.1-2537s1c1
Sequence:CCGGCCTGTTGTAACTCAACCCAAACTCGAGTTTGGGTTGAGTTACAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013559.1-2761s1c1
Sequence:CCGGGCCATAGTATGTGATCCTGTACTCGAGTACAGGATCACATACTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.1-343s1c1
Sequence:CCGGGAGATTTCATGGCAGAGCATTCTCGAGAATGCTCTGCCATGAAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013559.1-2200s1c1
Sequence:CCGGGCAGGCATACATTGACAAGTTCTCGAGAACTTGTCAATGTATGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013559.1-1003s1c1
Sequence:CCGGCGAGTGCTTTATGAATGACAACTCGAGTTGTCATTCATAAAGCACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013559.1-2762s1c1
Sequence:CCGGCCATAGTATGTGATCCTGTATCTCGAGATACAGGATCACATACTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013559.1-3227s1c1
Sequence:CCGGGCTAGTGAACTGTAGCAGCATCTCGAGATGCTGCTACAGTTCACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.1-1943s1c1
Sequence:CCGGGCCAACTTGGTATGGCAGTTACTCGAGTAACTGCCATACCAAGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-595s21c1
Sequence:CCGGCCATGCTGCTGACTAAGTTAACTCGAGTTAACTTAGTCAGCAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-2634s21c1
Sequence:CCGGCCTGTTGTAACTCAACCCAAACTCGAGTTTGGGTTGAGTTACAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.2-2067s1c1
Sequence:CCGGGACCTTCTTAACATGTATATTCTCGAGAATATACATGTTAAGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.2-1381s1c1
Sequence:CCGGCAATTCTTTCTCCGGCATTTACTCGAGTAAATGCCGGAGAAAGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.2-763s1c1
Sequence:CCGGCGGCTGTTGCTTTGAATTATGCTCGAGCATAATTCAAAGCAACAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-2858s21c1
Sequence:CCGGGCCATAGTATGTGATCCTGTACTCGAGTACAGGATCACATACTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-1103s21c1
Sequence:CCGGCGAGTGCTTTATGAATGACAACTCGAGTTGTCATTCATAAAGCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013559
VALIDATED
HSPH1 MISSION shRNA shRNA Plasmid DNA
heat shock 105kDa/110kDa protein 1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013559.1-2537s1c1
Sequence:CCGGCCTGTTGTAACTCAACCCAAACTCGAGTTTGGGTTGAGTTACAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013559.1-2761s1c1
Sequence:CCGGGCCATAGTATGTGATCCTGTACTCGAGTACAGGATCACATACTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.1-343s1c1
Sequence:CCGGGAGATTTCATGGCAGAGCATTCTCGAGAATGCTCTGCCATGAAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013559.1-2200s1c1
Sequence:CCGGGCAGGCATACATTGACAAGTTCTCGAGAACTTGTCAATGTATGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013559.1-1003s1c1
Sequence:CCGGCGAGTGCTTTATGAATGACAACTCGAGTTGTCATTCATAAAGCACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013559.1-2762s1c1
Sequence:CCGGCCATAGTATGTGATCCTGTATCTCGAGATACAGGATCACATACTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013559.1-3227s1c1
Sequence:CCGGGCTAGTGAACTGTAGCAGCATCTCGAGATGCTGCTACAGTTCACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.1-1943s1c1
Sequence:CCGGGCCAACTTGGTATGGCAGTTACTCGAGTAACTGCCATACCAAGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-595s21c1
Sequence:CCGGCCATGCTGCTGACTAAGTTAACTCGAGTTAACTTAGTCAGCAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-2634s21c1
Sequence:CCGGCCTGTTGTAACTCAACCCAAACTCGAGTTTGGGTTGAGTTACAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.2-2067s1c1
Sequence:CCGGGACCTTCTTAACATGTATATTCTCGAGAATATACATGTTAAGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.2-1381s1c1
Sequence:CCGGCAATTCTTTCTCCGGCATTTACTCGAGTAAATGCCGGAGAAAGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.2-763s1c1
Sequence:CCGGCGGCTGTTGCTTTGAATTATGCTCGAGCATAATTCAAAGCAACAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-2858s21c1
Sequence:CCGGGCCATAGTATGTGATCCTGTACTCGAGTACAGGATCACATACTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-1103s21c1
Sequence:CCGGCGAGTGCTTTATGAATGACAACTCGAGTTGTCATTCATAAAGCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013559
VALIDATED
HSPH1 MISSION shRNA Lentiviral Transduction Particles
heat shock 105kDa/110kDa protein 1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013559.1-2537s1c1
Sequence:CCGGCCTGTTGTAACTCAACCCAAACTCGAGTTTGGGTTGAGTTACAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180724    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013559.1-2761s1c1
Sequence:CCGGGCCATAGTATGTGATCCTGTACTCGAGTACAGGATCACATACTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180617    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.1-343s1c1
Sequence:CCGGGAGATTTCATGGCAGAGCATTCTCGAGAATGCTCTGCCATGAAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013559.1-2200s1c1
Sequence:CCGGGCAGGCATACATTGACAAGTTCTCGAGAACTTGTCAATGTATGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013559.1-1003s1c1
Sequence:CCGGCGAGTGCTTTATGAATGACAACTCGAGTTGTCATTCATAAAGCACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013559.1-2762s1c1
Sequence:CCGGCCATAGTATGTGATCCTGTATCTCGAGATACAGGATCACATACTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184444    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013559.1-3227s1c1
Sequence:CCGGGCTAGTGAACTGTAGCAGCATCTCGAGATGCTGCTACAGTTCACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184271    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.1-1943s1c1
Sequence:CCGGGCCAACTTGGTATGGCAGTTACTCGAGTAACTGCCATACCAAGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-595s21c1
Sequence:CCGGCCATGCTGCTGACTAAGTTAACTCGAGTTAACTTAGTCAGCAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-2634s21c1
Sequence:CCGGCCTGTTGTAACTCAACCCAAACTCGAGTTTGGGTTGAGTTACAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.2-2067s1c1
Sequence:CCGGGACCTTCTTAACATGTATATTCTCGAGAATATACATGTTAAGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.2-1381s1c1
Sequence:CCGGCAATTCTTTCTCCGGCATTTACTCGAGTAAATGCCGGAGAAAGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013559.2-763s1c1
Sequence:CCGGCGGCTGTTGCTTTGAATTATGCTCGAGCATAATTCAAAGCAACAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336031    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-2858s21c1
Sequence:CCGGGCCATAGTATGTGATCCTGTACTCGAGTACAGGATCACATACTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013559.2-1103s21c1
Sequence:CCGGCGAGTGCTTTATGAATGACAACTCGAGTTGTCATTCATAAAGCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006644
VALIDATED
HSPH1 MISSION shRNA Bacterial Glycerol Stock
heat shock 105kDa/110kDa protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006644.2-2183s1c1
Sequence:CCGGGCTGCCTATTGAAGCCAACTTCTCGAGAAGTTGGCTTCAATAGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-3393s1c1
Sequence:CCGGCAAGACTAAGTCTGACTTCATCTCGAGATGAAGTCAGACTTAGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006644.2-2028s1c1
Sequence:CCGGGTACAAACTGATGCTCAACAACTCGAGTTGTTGAGCATCAGTTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006644.2-2621s1c1
Sequence:CCGGCCATATTGATGAGTCTGAAATCTCGAGATTTCAGACTCATCAATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-3032s1c1
Sequence:CCGGGACTCTACATAACATACTGAACTCGAGTTCAGTATGTTATGTAGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-804s1c1
Sequence:CCGGCCAGTAACAGATTGTGTTATTCTCGAGAATAACACAATCTGTTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-1251s1c1
Sequence:CCGGCCACTGAATATCGAATGCTTTCTCGAGAAAGCATTCGATATTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-804s21c1
Sequence:CCGGCCAGTAACAGATTGTGTTATTCTCGAGAATAACACAATCTGTTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-929s21c1
Sequence:CCGGTGCTTTGAATTACGGAATTTACTCGAGTAAATTCCGTAATTCAAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006644.2-2183s21c1
Sequence:CCGGGCTGCCTATTGAAGCCAACTTCTCGAGAAGTTGGCTTCAATAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-3118s21c1
Sequence:CCGGAGCTTAAGTCTGTAGTCTTTACTCGAGTAAAGACTACAGACTTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-2608s21c1
Sequence:CCGGATGAGAAATACAACCATATTGCTCGAGCAATATGGTTGTATTTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006644
VALIDATED
HSPH1 MISSION shRNA shRNA Plasmid DNA
heat shock 105kDa/110kDa protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006644.2-2183s1c1
Sequence:CCGGGCTGCCTATTGAAGCCAACTTCTCGAGAAGTTGGCTTCAATAGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-3393s1c1
Sequence:CCGGCAAGACTAAGTCTGACTTCATCTCGAGATGAAGTCAGACTTAGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006644.2-2028s1c1
Sequence:CCGGGTACAAACTGATGCTCAACAACTCGAGTTGTTGAGCATCAGTTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006644.2-2621s1c1
Sequence:CCGGCCATATTGATGAGTCTGAAATCTCGAGATTTCAGACTCATCAATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-3032s1c1
Sequence:CCGGGACTCTACATAACATACTGAACTCGAGTTCAGTATGTTATGTAGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-804s1c1
Sequence:CCGGCCAGTAACAGATTGTGTTATTCTCGAGAATAACACAATCTGTTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-1251s1c1
Sequence:CCGGCCACTGAATATCGAATGCTTTCTCGAGAAAGCATTCGATATTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-804s21c1
Sequence:CCGGCCAGTAACAGATTGTGTTATTCTCGAGAATAACACAATCTGTTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-929s21c1
Sequence:CCGGTGCTTTGAATTACGGAATTTACTCGAGTAAATTCCGTAATTCAAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006644.2-2183s21c1
Sequence:CCGGGCTGCCTATTGAAGCCAACTTCTCGAGAAGTTGGCTTCAATAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-3118s21c1
Sequence:CCGGAGCTTAAGTCTGTAGTCTTTACTCGAGTAAAGACTACAGACTTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-2608s21c1
Sequence:CCGGATGAGAAATACAACCATATTGCTCGAGCAATATGGTTGTATTTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006644
VALIDATED
HSPH1 MISSION shRNA Lentiviral Transduction Particles
heat shock 105kDa/110kDa protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166087    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006644.2-2183s1c1
Sequence:CCGGGCTGCCTATTGAAGCCAACTTCTCGAGAAGTTGGCTTCAATAGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-3393s1c1
Sequence:CCGGCAAGACTAAGTCTGACTTCATCTCGAGATGAAGTCAGACTTAGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006644.2-2028s1c1
Sequence:CCGGGTACAAACTGATGCTCAACAACTCGAGTTGTTGAGCATCAGTTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006644.2-2621s1c1
Sequence:CCGGCCATATTGATGAGTCTGAAATCTCGAGATTTCAGACTCATCAATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159636    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-3032s1c1
Sequence:CCGGGACTCTACATAACATACTGAACTCGAGTTCAGTATGTTATGTAGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-804s1c1
Sequence:CCGGCCAGTAACAGATTGTGTTATTCTCGAGAATAACACAATCTGTTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006644.2-1251s1c1
Sequence:CCGGCCACTGAATATCGAATGCTTTCTCGAGAAAGCATTCGATATTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-804s21c1
Sequence:CCGGCCAGTAACAGATTGTGTTATTCTCGAGAATAACACAATCTGTTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-929s21c1
Sequence:CCGGTGCTTTGAATTACGGAATTTACTCGAGTAAATTCCGTAATTCAAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006644.2-2183s21c1
Sequence:CCGGGCTGCCTATTGAAGCCAACTTCTCGAGAAGTTGGCTTCAATAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275689    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-3118s21c1
Sequence:CCGGAGCTTAAGTCTGTAGTCTTTACTCGAGTAAAGACTACAGACTTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006644.2-2608s21c1
Sequence:CCGGATGAGAAATACAACCATATTGCTCGAGCAATATGGTTGTATTTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)