EMAIL THIS PAGE TO A FRIEND

HTATIP2

HIV-1 Tat interactive protein 2, 30kDa

107 Gene Product Result for
Synonyms: CC3 SDR44U1 TIP30
Gene ID:
Mouse(53415) HIV-1 tat interactive protein 2, homolog (human)
Rat(292935) HIV-1 Tat interactive protein 2
Zebrafish(64605) HIV-1 Tat interactive protein 2
domestic cat(101084478) HIV-1 Tat interactive protein 2, 30kDa
cow(539276) HIV-1 Tat interactive protein 2, 30kDa
dog(476886) HIV-1 Tat interactive protein 2, 30kDa
chicken(424363) HIV-1 Tat interactive protein 2, 30kDa
sheep(101114318) HIV-1 Tat interactive protein 2, 30kDa
domestic guinea pig(100722679) HIV-1 Tat interactive protein 2, 30kDa
naked mole-rat(101724677) HIV-1 Tat interactive protein 2, 30kDa
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006410 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006410 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006410 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047111 MISSION® esiRNA esiRNA human HTATIP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098520 Rosetta Predictions human pricing
NM_001098521 Rosetta Predictions human pricing
NM_001098522 Rosetta Predictions human pricing
NM_001098523 Rosetta Predictions human pricing
NM_006410 Rosetta Predictions human pricing
NM_001106263 Rosetta Predictions rat pricing
XM_214927 Rosetta Predictions rat pricing
NM_016865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319257 predicted 562
2 SASI_Hs02_00319258 predicted 781
3 SASI_Hs02_00319259 predicted 552
4 SASI_Hs02_00319260 predicted 538
5 SASI_Hs02_00319261 predicted 567
6 SASI_Hs02_00319262 predicted 429
7 SASI_Hs02_00319263 predicted 442
8 SASI_Hs02_00319264 predicted 553
9 SASI_Hs02_00319265 predicted 538
10 SASI_Hs02_00319266 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319267 predicted 483
2 SASI_Hs02_00319268 predicted 706
3 SASI_Hs02_00319269 predicted 482
4 SASI_Hs02_00319270 predicted 460
5 SASI_Hs02_00319271 predicted 494
6 SASI_Hs02_00319272 predicted 355
7 SASI_Hs02_00319273 predicted 370
8 SASI_Hs02_00319274 predicted 485
9 SASI_Hs02_00319275 predicted 468
10 SASI_Hs02_00319276 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319277 predicted 767
2 SASI_Hs02_00319278 predicted 988
3 SASI_Hs02_00319279 predicted 761
4 SASI_Hs02_00319280 predicted 748
5 SASI_Hs02_00319281 predicted 777
6 SASI_Hs02_00319282 predicted 638
7 SASI_Hs02_00319283 predicted 645
8 SASI_Hs02_00319284 predicted 763
9 SASI_Hs02_00319285 predicted 753
10 SASI_Hs02_00319286 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319287 predicted 256
2 SASI_Hs02_00319288 predicted 255
3 SASI_Hs02_00319289 predicted 333
4 SASI_Hs02_00319290 predicted 389
5 SASI_Hs02_00319291 predicted 426
6 SASI_Hs02_00319292 predicted 362
7 SASI_Hs02_00319293 predicted 434
8 SASI_Hs02_00319294 predicted 535
9 SASI_Hs02_00319295 predicted 232
10 SASI_Hs02_00319296 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006410 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236827 predicted 456
2 SASI_Hs01_00236828 predicted 677
3 SASI_Hs01_00236829 predicted 441
4 SASI_Hs01_00236831 predicted 426
5 SASI_Hs01_00236832 predicted 466
6 SASI_Hs01_00236833 predicted 320
7 SASI_Hs01_00236834 predicted 335
8 SASI_Hs02_00341505 predicted 453
9 SASI_Hs02_00341506 predicted 432
10 SASI_Hs02_00341507 predicted 542
11 SASI_Hs01_00236826 predicted 277
12 SASI_Hs01_00236830 predicted 206
13 SASI_Hs01_00236835 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217248 predicted 459
2 SASI_Rn02_00217249 predicted 626
3 SASI_Rn02_00217250 predicted 421
4 SASI_Rn02_00217251 predicted 575
5 SASI_Rn02_00217252 predicted 376
6 SASI_Rn02_00217253 predicted 940
7 SASI_Rn02_00217254 predicted 374
8 SASI_Rn02_00217255 predicted 411
9 SASI_Rn02_00217256 predicted 199
10 SASI_Rn02_00217257 predicted 350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165893 predicted 597
2 SASI_Rn01_00165894 predicted 550
3 SASI_Rn01_00165895 predicted 706
4 SASI_Rn01_00165896 predicted 513
5 SASI_Rn01_00165897 predicted 1068
6 SASI_Rn01_00165898 predicted 506
7 SASI_Rn01_00165899 predicted 547
8 SASI_Rn01_00165900 predicted 332
9 SASI_Rn01_00165901 predicted 281
10 SASI_Rn01_00165902 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192336 predicted 606
2 SASI_Mm01_00192337 predicted 319
3 SASI_Mm01_00192338 predicted 1016
4 SASI_Mm01_00192339 predicted 461
5 SASI_Mm01_00192340 predicted 529
6 SASI_Mm01_00192341 predicted 1090
7 SASI_Mm01_00192342 predicted 523
8 SASI_Mm01_00192343 predicted 1087
9 SASI_Mm01_00192344 predicted 240
10 SASI_Mm01_00192345 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016865
VALIDATED
HTATIP2 MISSION shRNA Bacterial Glycerol Stock
HIV-1 Tat interactive protein 2, 30kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-375s21c1
Sequence:CCGGCTTCGAGGAGGAAGCTTATAACTCGAGTTATAAGCTTCCTCCTCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-338s21c1
Sequence:CCGGTTTCCAAAGTAACGCTCATTGCTCGAGCAATGAGCGTTACTTTGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-520s21c1
Sequence:CCGGGTTCGTGTTGACCGAGATTATCTCGAGATAATCTCGGTCAACACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016865.3-970s21c1
Sequence:CCGGCCTGTCACCAAATCAGTCATTCTCGAGAATGACTGATTTGGTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-244s21c1
Sequence:CCGGGACTTCAAGATGCAGAATAAACTCGAGTTTATTCTGCATCTTGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-923s1c1
Sequence:CCGGCCTGTCACCAAATCAGTCATTCTCGAGAATGACTGATTTGGTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016865.2-472s1c1
Sequence:CCGGTGTTCGTGTTGACCGAGATTACTCGAGTAATCTCGGTCAACACGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-473s1c1
Sequence:CCGGGTTCGTGTTGACCGAGATTATCTCGAGATAATCTCGGTCAACACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-565s1c1
Sequence:CCGGCGATAAGTCCAGCAGTTTCTTCTCGAGAAGAAACTGCTGGACTTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-197s1c1
Sequence:CCGGGACTTCAAGATGCAGAATAAACTCGAGTTTATTCTGCATCTTGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016865
VALIDATED
HTATIP2 MISSION shRNA shRNA Plasmid DNA
HIV-1 Tat interactive protein 2, 30kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-375s21c1
Sequence:CCGGCTTCGAGGAGGAAGCTTATAACTCGAGTTATAAGCTTCCTCCTCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-338s21c1
Sequence:CCGGTTTCCAAAGTAACGCTCATTGCTCGAGCAATGAGCGTTACTTTGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-520s21c1
Sequence:CCGGGTTCGTGTTGACCGAGATTATCTCGAGATAATCTCGGTCAACACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016865.3-970s21c1
Sequence:CCGGCCTGTCACCAAATCAGTCATTCTCGAGAATGACTGATTTGGTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-244s21c1
Sequence:CCGGGACTTCAAGATGCAGAATAAACTCGAGTTTATTCTGCATCTTGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-923s1c1
Sequence:CCGGCCTGTCACCAAATCAGTCATTCTCGAGAATGACTGATTTGGTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016865.2-472s1c1
Sequence:CCGGTGTTCGTGTTGACCGAGATTACTCGAGTAATCTCGGTCAACACGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-473s1c1
Sequence:CCGGGTTCGTGTTGACCGAGATTATCTCGAGATAATCTCGGTCAACACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-565s1c1
Sequence:CCGGCGATAAGTCCAGCAGTTTCTTCTCGAGAAGAAACTGCTGGACTTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-197s1c1
Sequence:CCGGGACTTCAAGATGCAGAATAAACTCGAGTTTATTCTGCATCTTGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016865
VALIDATED
HTATIP2 MISSION shRNA Lentiviral Transduction Particles
HIV-1 Tat interactive protein 2, 30kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-375s21c1
Sequence:CCGGCTTCGAGGAGGAAGCTTATAACTCGAGTTATAAGCTTCCTCCTCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-338s21c1
Sequence:CCGGTTTCCAAAGTAACGCTCATTGCTCGAGCAATGAGCGTTACTTTGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-520s21c1
Sequence:CCGGGTTCGTGTTGACCGAGATTATCTCGAGATAATCTCGGTCAACACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016865.3-970s21c1
Sequence:CCGGCCTGTCACCAAATCAGTCATTCTCGAGAATGACTGATTTGGTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016865.3-244s21c1
Sequence:CCGGGACTTCAAGATGCAGAATAAACTCGAGTTTATTCTGCATCTTGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078918    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-923s1c1
Sequence:CCGGCCTGTCACCAAATCAGTCATTCTCGAGAATGACTGATTTGGTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016865.2-472s1c1
Sequence:CCGGTGTTCGTGTTGACCGAGATTACTCGAGTAATCTCGGTCAACACGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-473s1c1
Sequence:CCGGGTTCGTGTTGACCGAGATTATCTCGAGATAATCTCGGTCAACACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-565s1c1
Sequence:CCGGCGATAAGTCCAGCAGTTTCTTCTCGAGAAGAAACTGCTGGACTTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016865.2-197s1c1
Sequence:CCGGGACTTCAAGATGCAGAATAAACTCGAGTTTATTCTGCATCTTGAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006410
VALIDATED
HTATIP2 MISSION shRNA Bacterial Glycerol Stock
HIV-1 Tat interactive protein 2, 30kDa
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006410.4-458s21c1
Sequence:CCGGCCTCTAAAGGAGCTGATAAATCTCGAGATTTATCAGCTCCTTTAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-681s21c1
Sequence:CCGGCGTGGTTAGAGCAATGCTGAACTCGAGTTCAGCATTGCTCTAACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-235s21c1
Sequence:CCGGTTCGACGAGGAAGCTTATAAACTCGAGTTTATAAGCTTCCTCGTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-834s21c1
Sequence:CCGGCCCATCACCAAATCGGTAATTCTCGAGAATTACCGATTTGGTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-114s21c1
Sequence:CCGGGCAGAATAAATCCGTCTTTATCTCGAGATAAAGACGGATTTATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-880s1c1
Sequence:CCGGCCCATCACCAAATCGGTAATTCTCGAGAATTACCGATTTGGTGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-160s1c1
Sequence:CCGGGCAGAATAAATCCGTCTTTATCTCGAGATAAAGACGGATTTATTCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-504s1c1
Sequence:CCGGCCTCTAAAGGAGCTGATAAATCTCGAGATTTATCAGCTCCTTTAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-727s1c1
Sequence:CCGGCGTGGTTAGAGCAATGCTGAACTCGAGTTCAGCATTGCTCTAACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006410.3-483s1c1
Sequence:CCGGGCAAACATTTCAACTTGCTATCTCGAGATAGCAAGTTGAAATGTTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006410
VALIDATED
HTATIP2 MISSION shRNA shRNA Plasmid DNA
HIV-1 Tat interactive protein 2, 30kDa
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006410.4-458s21c1
Sequence:CCGGCCTCTAAAGGAGCTGATAAATCTCGAGATTTATCAGCTCCTTTAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-681s21c1
Sequence:CCGGCGTGGTTAGAGCAATGCTGAACTCGAGTTCAGCATTGCTCTAACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-235s21c1
Sequence:CCGGTTCGACGAGGAAGCTTATAAACTCGAGTTTATAAGCTTCCTCGTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-834s21c1
Sequence:CCGGCCCATCACCAAATCGGTAATTCTCGAGAATTACCGATTTGGTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-114s21c1
Sequence:CCGGGCAGAATAAATCCGTCTTTATCTCGAGATAAAGACGGATTTATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-880s1c1
Sequence:CCGGCCCATCACCAAATCGGTAATTCTCGAGAATTACCGATTTGGTGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-160s1c1
Sequence:CCGGGCAGAATAAATCCGTCTTTATCTCGAGATAAAGACGGATTTATTCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-504s1c1
Sequence:CCGGCCTCTAAAGGAGCTGATAAATCTCGAGATTTATCAGCTCCTTTAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-727s1c1
Sequence:CCGGCGTGGTTAGAGCAATGCTGAACTCGAGTTCAGCATTGCTCTAACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006410.3-483s1c1
Sequence:CCGGGCAAACATTTCAACTTGCTATCTCGAGATAGCAAGTTGAAATGTTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006410
VALIDATED
HTATIP2 MISSION shRNA Lentiviral Transduction Particles
HIV-1 Tat interactive protein 2, 30kDa
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006410.4-458s21c1
Sequence:CCGGCCTCTAAAGGAGCTGATAAATCTCGAGATTTATCAGCTCCTTTAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-681s21c1
Sequence:CCGGCGTGGTTAGAGCAATGCTGAACTCGAGTTCAGCATTGCTCTAACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-235s21c1
Sequence:CCGGTTCGACGAGGAAGCTTATAAACTCGAGTTTATAAGCTTCCTCGTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280451    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-834s21c1
Sequence:CCGGCCCATCACCAAATCGGTAATTCTCGAGAATTACCGATTTGGTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_006410.4-114s21c1
Sequence:CCGGGCAGAATAAATCCGTCTTTATCTCGAGATAAAGACGGATTTATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-880s1c1
Sequence:CCGGCCCATCACCAAATCGGTAATTCTCGAGAATTACCGATTTGGTGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-160s1c1
Sequence:CCGGGCAGAATAAATCCGTCTTTATCTCGAGATAAAGACGGATTTATTCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-504s1c1
Sequence:CCGGCCTCTAAAGGAGCTGATAAATCTCGAGATTTATCAGCTCCTTTAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006410.3-727s1c1
Sequence:CCGGCGTGGTTAGAGCAATGCTGAACTCGAGTTCAGCATTGCTCTAACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006410.3-483s1c1
Sequence:CCGGGCAAACATTTCAACTTGCTATCTCGAGATAGCAAGTTGAAATGTTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)