EMAIL THIS PAGE TO A FRIEND

HTATSF1

HIV-1 Tat specific factor 1

64 Gene Product Result for
Synonyms: TAT-SF1 TATSF1 dJ196E23.2
UniProtKB ID: O43719, D3DWG9, Q59G06, Q99730
Gene ID:
Human(27336) Summary: The protein encoded by this gene functions as a cofactor for the stimulation of transcriptional elongation by HIV-1 Tat, which binds to the HIV-1 promoter through Tat-TAR interaction. This protein may also serve as a dual-function factor to couple transcription and splicing and to facilitate their reciprocal activation. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Sep 2009]
Mouse(72459) HIV TAT specific factor 1
Rat(317612) HIV-1 Tat specific factor 1
domestic guinea pig(100733942) HIV-1 Tat specific factor 1
naked mole-rat(101701332) HIV-1 Tat specific factor 1
sheep(101104556) HIV-1 Tat specific factor 1
Domestic Rabbit(100357941) HIV-1 Tat specific factor 1
Zebrafish(394178) HIV TAT specific factor 1
cow(526910) HIV-1 Tat specific factor 1
domestic cat(101083407) HIV-1 Tat specific factor 1
dog(481062) HIV-1 Tat specific factor 1
chicken(422245) HIV-1 Tat specific factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014500 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014500 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014500 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028242 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028242 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028242 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014500 Rosetta Predictions human pricing
NM_001108259 Rosetta Predictions rat pricing
NM_028242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227759 predicted 1839
2 SASI_Hs01_00227760 predicted 2494
3 SASI_Hs01_00227761 predicted 2310
4 SASI_Hs01_00227763 predicted 664
5 SASI_Hs01_00227765 predicted 585
6 SASI_Hs01_00227766 predicted 1624
7 SASI_Hs01_00227767 predicted 2400
8 SASI_Hs01_00227768 predicted 1142
9 SASI_Hs02_00345754 predicted 412
10 SASI_Hs02_00345755 predicted 2103
11 SASI_Hs01_00227762 predicted 787
12 SASI_Hs01_00227764 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108259 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236894 predicted 1226
2 SASI_Rn02_00236895 predicted 1036
3 SASI_Rn02_00236896 predicted 778
4 SASI_Rn02_00236897 predicted 1349
5 SASI_Rn02_00236898 predicted 716
6 SASI_Rn02_00236899 predicted 2089
7 SASI_Rn02_00236900 predicted 556
8 SASI_Rn02_00236901 predicted 2212
9 SASI_Rn02_00236902 predicted 2114
10 SASI_Rn02_00236903 predicted 2335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186955 predicted 672
2 SASI_Mm01_00186956 predicted 712
3 SASI_Mm01_00186957 predicted 2358
4 SASI_Mm01_00186958 predicted 1461
5 SASI_Mm01_00186959 predicted 737
6 SASI_Mm01_00186960 predicted 249
7 SASI_Mm01_00186961 predicted 1263
8 SASI_Mm01_00186962 predicted 2118
9 SASI_Mm01_00186963 predicted 1883
10 SASI_Mm01_00186964 predicted 2445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014500
VALIDATED
HTATSF1 MISSION shRNA Bacterial Glycerol Stock
HIV-1 Tat specific factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014500.3-1855s1c1
Sequence:CCGGCCGAAAGAGAATTTGAAGAAACTCGAGTTTCTTCAAATTCTCTTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014500.3-2544s1c1
Sequence:CCGGGCCATCAGATTAAAGCATTGACTCGAGTCAATGCTTTAATCTGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014500.3-1422s1c1
Sequence:CCGGGCAACTGGAATGGCGTTTGAACTCGAGTTCAAACGCCATTCCAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014500.3-378s1c1
Sequence:CCGGGCTACATATCAGGCCAATTATCTCGAGATAATTGGCCTGATATGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014500.3-416s1c1
Sequence:CCGGCGCATCTAGTTCTACCGCAAACTCGAGTTTGCGGTAGAACTAGATGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-1135s21c1
Sequence:CCGGATCCAGAGGAAGCTGATTATTCTCGAGAATAATCAGCTTCCTCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-1855s21c1
Sequence:CCGGCCGAAAGAGAATTTGAAGAAACTCGAGTTTCTTCAAATTCTCTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014500.3-2485s21c1
Sequence:CCGGGCCTGTGCTTCAGGGTAATTACTCGAGTAATTACCCTGAAGCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-1422s21c1
Sequence:CCGGGCAACTGGAATGGCGTTTGAACTCGAGTTCAAACGCCATTCCAGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-416s21c1
Sequence:CCGGCGCATCTAGTTCTACCGCAAACTCGAGTTTGCGGTAGAACTAGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014500
VALIDATED
HTATSF1 MISSION shRNA shRNA Plasmid DNA
HIV-1 Tat specific factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014500.3-1855s1c1
Sequence:CCGGCCGAAAGAGAATTTGAAGAAACTCGAGTTTCTTCAAATTCTCTTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014500.3-2544s1c1
Sequence:CCGGGCCATCAGATTAAAGCATTGACTCGAGTCAATGCTTTAATCTGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014500.3-1422s1c1
Sequence:CCGGGCAACTGGAATGGCGTTTGAACTCGAGTTCAAACGCCATTCCAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014500.3-378s1c1
Sequence:CCGGGCTACATATCAGGCCAATTATCTCGAGATAATTGGCCTGATATGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014500.3-416s1c1
Sequence:CCGGCGCATCTAGTTCTACCGCAAACTCGAGTTTGCGGTAGAACTAGATGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-1135s21c1
Sequence:CCGGATCCAGAGGAAGCTGATTATTCTCGAGAATAATCAGCTTCCTCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-1855s21c1
Sequence:CCGGCCGAAAGAGAATTTGAAGAAACTCGAGTTTCTTCAAATTCTCTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014500.3-2485s21c1
Sequence:CCGGGCCTGTGCTTCAGGGTAATTACTCGAGTAATTACCCTGAAGCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-1422s21c1
Sequence:CCGGGCAACTGGAATGGCGTTTGAACTCGAGTTCAAACGCCATTCCAGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-416s21c1
Sequence:CCGGCGCATCTAGTTCTACCGCAAACTCGAGTTTGCGGTAGAACTAGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014500
VALIDATED
HTATSF1 MISSION shRNA Lentiviral Transduction Particles
HIV-1 Tat specific factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014500.3-1855s1c1
Sequence:CCGGCCGAAAGAGAATTTGAAGAAACTCGAGTTTCTTCAAATTCTCTTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014500.3-2544s1c1
Sequence:CCGGGCCATCAGATTAAAGCATTGACTCGAGTCAATGCTTTAATCTGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014500.3-1422s1c1
Sequence:CCGGGCAACTGGAATGGCGTTTGAACTCGAGTTCAAACGCCATTCCAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014500.3-378s1c1
Sequence:CCGGGCTACATATCAGGCCAATTATCTCGAGATAATTGGCCTGATATGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014500.3-416s1c1
Sequence:CCGGCGCATCTAGTTCTACCGCAAACTCGAGTTTGCGGTAGAACTAGATGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-1135s21c1
Sequence:CCGGATCCAGAGGAAGCTGATTATTCTCGAGAATAATCAGCTTCCTCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-1855s21c1
Sequence:CCGGCCGAAAGAGAATTTGAAGAAACTCGAGTTTCTTCAAATTCTCTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014500.3-2485s21c1
Sequence:CCGGGCCTGTGCTTCAGGGTAATTACTCGAGTAATTACCCTGAAGCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-1422s21c1
Sequence:CCGGGCAACTGGAATGGCGTTTGAACTCGAGTTCAAACGCCATTCCAGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014500.3-416s21c1
Sequence:CCGGCGCATCTAGTTCTACCGCAAACTCGAGTTTGCGGTAGAACTAGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028242
VALIDATED
HTATSF1 MISSION shRNA Bacterial Glycerol Stock
HIV-1 Tat specific factor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-2592s1c1
Sequence:CCGGCCATCTGACTAATGTCTCGAACTCGAGTTCGAGACATTAGTCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-2363s1c1
Sequence:CCGGCCCAATGAGAAGTTGTTTGATCTCGAGATCAAACAACTTCTCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-400s1c1
Sequence:CCGGCCCTAAGATCACCGAAGATTTCTCGAGAAATCTTCGGTGATCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-494s1c1
Sequence:CCGGGCCAACACTAAGGCTGTAGAACTCGAGTTCTACAGCCTTAGTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-1432s1c1
Sequence:CCGGGCACCCAAGTATGTCTAATATCTCGAGATATTAGACATACTTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028242.1-400s21c1
Sequence:CCGGCCCTAAGATCACCGAAGATTTCTCGAGAAATCTTCGGTGATCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028242.1-2592s21c1
Sequence:CCGGCCATCTGACTAATGTCTCGAACTCGAGTTCGAGACATTAGTCAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028242.1-2108s21c1
Sequence:CCGGGATGAAGAAGAGGTCGTATATCTCGAGATATACGACCTCTTCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028242.1-2363s21c1
Sequence:CCGGCCCAATGAGAAGTTGTTTGATCTCGAGATCAAACAACTTCTCATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028242
VALIDATED
HTATSF1 MISSION shRNA shRNA Plasmid DNA
HIV-1 Tat specific factor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-2592s1c1
Sequence:CCGGCCATCTGACTAATGTCTCGAACTCGAGTTCGAGACATTAGTCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-2363s1c1
Sequence:CCGGCCCAATGAGAAGTTGTTTGATCTCGAGATCAAACAACTTCTCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-400s1c1
Sequence:CCGGCCCTAAGATCACCGAAGATTTCTCGAGAAATCTTCGGTGATCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-494s1c1
Sequence:CCGGGCCAACACTAAGGCTGTAGAACTCGAGTTCTACAGCCTTAGTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-1432s1c1
Sequence:CCGGGCACCCAAGTATGTCTAATATCTCGAGATATTAGACATACTTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028242.1-400s21c1
Sequence:CCGGCCCTAAGATCACCGAAGATTTCTCGAGAAATCTTCGGTGATCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028242.1-2592s21c1
Sequence:CCGGCCATCTGACTAATGTCTCGAACTCGAGTTCGAGACATTAGTCAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028242.1-2108s21c1
Sequence:CCGGGATGAAGAAGAGGTCGTATATCTCGAGATATACGACCTCTTCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028242.1-2363s21c1
Sequence:CCGGCCCAATGAGAAGTTGTTTGATCTCGAGATCAAACAACTTCTCATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028242
VALIDATED
HTATSF1 MISSION shRNA Lentiviral Transduction Particles
HIV-1 Tat specific factor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-2592s1c1
Sequence:CCGGCCATCTGACTAATGTCTCGAACTCGAGTTCGAGACATTAGTCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-2363s1c1
Sequence:CCGGCCCAATGAGAAGTTGTTTGATCTCGAGATCAAACAACTTCTCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-400s1c1
Sequence:CCGGCCCTAAGATCACCGAAGATTTCTCGAGAAATCTTCGGTGATCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-494s1c1
Sequence:CCGGGCCAACACTAAGGCTGTAGAACTCGAGTTCTACAGCCTTAGTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028242.1-1432s1c1
Sequence:CCGGGCACCCAAGTATGTCTAATATCTCGAGATATTAGACATACTTGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028242.1-400s21c1
Sequence:CCGGCCCTAAGATCACCGAAGATTTCTCGAGAAATCTTCGGTGATCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028242.1-2592s21c1
Sequence:CCGGCCATCTGACTAATGTCTCGAACTCGAGTTCGAGACATTAGTCAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028242.1-2108s21c1
Sequence:CCGGGATGAAGAAGAGGTCGTATATCTCGAGATATACGACCTCTTCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028242.1-2363s21c1
Sequence:CCGGCCCAATGAGAAGTTGTTTGATCTCGAGATCAAACAACTTCTCATTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)