EMAIL THIS PAGE TO A FRIEND

HTATSF1P2

HIV-1 Tat specific factor 1 pseudogene 2

42 Gene Product Result for
Species: Human HTATSF1P2(401233)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013680 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013680 Rosetta Predictions human pricing
XR_040702 Rosetta Predictions human pricing
XR_040703 Rosetta Predictions human pricing
XR_040704 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247075 predicted 340
2 SASI_Hs01_00247076 predicted 452
3 SASI_Hs01_00247077 predicted 368
4 SASI_Hs01_00247078 predicted 377
5 SASI_Hs01_00247079 predicted 315
6 SASI_Hs01_00247080 predicted 354
7 SASI_Hs01_00247081 predicted 313
8 SASI_Hs01_00247082 predicted 1378
9 SASI_Hs01_00247083 predicted 1379
10 SASI_Hs01_00247084 predicted 1372
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521147 predicted 865
2 SASI_Hs02_00521148 predicted 582
3 SASI_Hs02_00521149 predicted 469
4 SASI_Hs02_00521150 predicted 399
5 SASI_Hs02_00521151 predicted 469
6 SASI_Hs02_00521152 predicted 483
7 SASI_Hs02_00521153 predicted 395
8 SASI_Hs02_00521154 predicted 646
9 SASI_Hs02_00521155 predicted 648
10 SASI_Hs02_00521156 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521157 predicted 583
2 SASI_Hs02_00521158 predicted 864
3 SASI_Hs02_00521159 predicted 592
4 SASI_Hs02_00521160 predicted 468
5 SASI_Hs02_00521161 predicted 466
6 SASI_Hs02_00521162 predicted 483
7 SASI_Hs02_00521163 predicted 395
8 SASI_Hs02_00521164 predicted 649
9 SASI_Hs02_00521165 predicted 640
10 SASI_Hs02_00521166 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521167 predicted 865
2 SASI_Hs02_00521168 predicted 581
3 SASI_Hs02_00521169 predicted 463
4 SASI_Hs02_00521170 predicted 400
5 SASI_Hs02_00521171 predicted 472
6 SASI_Hs02_00521172 predicted 487
7 SASI_Hs02_00521173 predicted 399
8 SASI_Hs02_00521174 predicted 651
9 SASI_Hs02_00521175 predicted 646
10 SASI_Hs02_00521176 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013680
HTATSF1P2 MISSION shRNA Bacterial Glycerol Stock
HIV-1 Tat specific factor 1 pseudogene 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-385s1c1
Sequence:CCGGGCATTCATGCATTTGGATGAACTCGAGTTCATCCAAATGCATGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-317s1c1
Sequence:CCGGGAGATAACCAAGGACATCTTACTCGAGTAAGATGTCCTTGGTTATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-721s1c1
Sequence:CCGGGCTCATTGTATTCAAACCTTTCTCGAGAAAGGTTTGAATACAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-733s1c1
Sequence:CCGGCAAACCTTTGATGGTCTCATTCTCGAGAATGAGACCATCAAAGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013680.1-2281s1c1
Sequence:CCGGCGGATGCAATTTCAGGAGCAACTCGAGTTGCTCCTGAAATTGCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-936s1c1
Sequence:CCGGGCCTCAAACTGCTGAACTCAACTCGAGTTGAGTTCAGCAGTTTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-716s1c1
Sequence:CCGGCAGCTGCTCATTGTATTCAAACTCGAGTTTGAATACAATGAGCAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-561s1c1
Sequence:CCGGGAGTGAGTTGTCCTCATCGAACTCGAGTTCGATGAGGACAACTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013680
HTATSF1P2 MISSION shRNA shRNA Plasmid DNA
HIV-1 Tat specific factor 1 pseudogene 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-385s1c1
Sequence:CCGGGCATTCATGCATTTGGATGAACTCGAGTTCATCCAAATGCATGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-317s1c1
Sequence:CCGGGAGATAACCAAGGACATCTTACTCGAGTAAGATGTCCTTGGTTATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-721s1c1
Sequence:CCGGGCTCATTGTATTCAAACCTTTCTCGAGAAAGGTTTGAATACAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-733s1c1
Sequence:CCGGCAAACCTTTGATGGTCTCATTCTCGAGAATGAGACCATCAAAGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013680.1-2281s1c1
Sequence:CCGGCGGATGCAATTTCAGGAGCAACTCGAGTTGCTCCTGAAATTGCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-936s1c1
Sequence:CCGGGCCTCAAACTGCTGAACTCAACTCGAGTTGAGTTCAGCAGTTTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-716s1c1
Sequence:CCGGCAGCTGCTCATTGTATTCAAACTCGAGTTTGAATACAATGAGCAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-561s1c1
Sequence:CCGGGAGTGAGTTGTCCTCATCGAACTCGAGTTCGATGAGGACAACTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013680
HTATSF1P2 MISSION shRNA Lentiviral Transduction Particles
HIV-1 Tat specific factor 1 pseudogene 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-385s1c1
Sequence:CCGGGCATTCATGCATTTGGATGAACTCGAGTTCATCCAAATGCATGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-317s1c1
Sequence:CCGGGAGATAACCAAGGACATCTTACTCGAGTAAGATGTCCTTGGTTATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-721s1c1
Sequence:CCGGGCTCATTGTATTCAAACCTTTCTCGAGAAAGGTTTGAATACAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-733s1c1
Sequence:CCGGCAAACCTTTGATGGTCTCATTCTCGAGAATGAGACCATCAAAGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173017    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013680.1-2281s1c1
Sequence:CCGGCGGATGCAATTTCAGGAGCAACTCGAGTTGCTCCTGAAATTGCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172860    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-936s1c1
Sequence:CCGGGCCTCAAACTGCTGAACTCAACTCGAGTTGAGTTCAGCAGTTTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168815    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-716s1c1
Sequence:CCGGCAGCTGCTCATTGTATTCAAACTCGAGTTTGAATACAATGAGCAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172729    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013680.1-561s1c1
Sequence:CCGGGAGTGAGTTGTCCTCATCGAACTCGAGTTCGATGAGGACAACTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)