EMAIL THIS PAGE TO A FRIEND

HTN1

histatin 1

17 Gene Product Result for
Synonyms: HIS1
Species: Human HTN1(3346)
UniProtKB ID: P15515
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405974 Anti-HTN1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002159 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127741 MISSION® esiRNA esiRNA human HTN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002159 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333363 predicted 308
2 SASI_Hs02_00333364 predicted 112
3 SASI_Hs02_00333365 predicted 102
4 SASI_Hs01_00124586 predicted 271
5 SASI_Hs01_00124587 predicted 264
6 SASI_Hs01_00124588 predicted 207
7 SASI_Hs01_00124589 predicted 236
8 SASI_Hs01_00124590 predicted 205
9 SASI_Hs01_00124591 predicted 237
10 SASI_Hs01_00124592 predicted 229
11 SASI_Hs01_00124593 predicted 275
12 SASI_Hs01_00124594 predicted 231
13 SASI_Hs01_00124595 predicted 274
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002159
HTN1 MISSION shRNA Bacterial Glycerol Stock
histatin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002159.2-98s1c1
Sequence:CCGGGCTCTCATGATTTCCATGATTCTCGAGAATCATGGAAATCATGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002159.2-358s1c1
Sequence:CCGGCATAAGGCAATGGAGAATAAACTCGAGTTTATTCTCCATTGCCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149105    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002159.2-405s1c1
Sequence:CCGGGTGTTTCATGATACTTCCCTTCTCGAGAAGGGAAGTATCATGAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002159.2-179s1c1
Sequence:CCGGCATTCACATCGAGAATTTCCACTCGAGTGGAAATTCTCGATGTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002159.2-411s1c1
Sequence:CCGGCATGATACTTCCCTTCCTAATCTCGAGATTAGGAAGGGAAGTATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002159.2-207s21c1
Sequence:CCGGGGGACTATGGATCAAATTATCCTCGAGGATAATTTGATCCATAGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002159.2-299s21c1
Sequence:CCGGACTCATTTATTCTCATTCATCCTCGAGGATGAATGAGAATAAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002159.2-238s21c1
Sequence:CCGGTTGATATCCTTAGTAATCATGCTCGAGCATGATTACTAAGGATATCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002159
HTN1 MISSION shRNA shRNA Plasmid DNA
histatin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002159.2-98s1c1
Sequence:CCGGGCTCTCATGATTTCCATGATTCTCGAGAATCATGGAAATCATGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002159.2-358s1c1
Sequence:CCGGCATAAGGCAATGGAGAATAAACTCGAGTTTATTCTCCATTGCCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149105    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002159.2-405s1c1
Sequence:CCGGGTGTTTCATGATACTTCCCTTCTCGAGAAGGGAAGTATCATGAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002159.2-179s1c1
Sequence:CCGGCATTCACATCGAGAATTTCCACTCGAGTGGAAATTCTCGATGTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002159.2-411s1c1
Sequence:CCGGCATGATACTTCCCTTCCTAATCTCGAGATTAGGAAGGGAAGTATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002159.2-207s21c1
Sequence:CCGGGGGACTATGGATCAAATTATCCTCGAGGATAATTTGATCCATAGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002159.2-299s21c1
Sequence:CCGGACTCATTTATTCTCATTCATCCTCGAGGATGAATGAGAATAAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002159.2-238s21c1
Sequence:CCGGTTGATATCCTTAGTAATCATGCTCGAGCATGATTACTAAGGATATCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002159
HTN1 MISSION shRNA Lentiviral Transduction Particles
histatin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183481    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002159.2-98s1c1
Sequence:CCGGGCTCTCATGATTTCCATGATTCTCGAGAATCATGGAAATCATGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183042    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002159.2-358s1c1
Sequence:CCGGCATAAGGCAATGGAGAATAAACTCGAGTTTATTCTCCATTGCCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149105    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002159.2-405s1c1
Sequence:CCGGGTGTTTCATGATACTTCCCTTCTCGAGAAGGGAAGTATCATGAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002159.2-179s1c1
Sequence:CCGGCATTCACATCGAGAATTTCCACTCGAGTGGAAATTCTCGATGTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147056    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002159.2-411s1c1
Sequence:CCGGCATGATACTTCCCTTCCTAATCTCGAGATTAGGAAGGGAAGTATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002159.2-207s21c1
Sequence:CCGGGGGACTATGGATCAAATTATCCTCGAGGATAATTTGATCCATAGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372404    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002159.2-299s21c1
Sequence:CCGGACTCATTTATTCTCATTCATCCTCGAGGATGAATGAGAATAAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002159.2-238s21c1
Sequence:CCGGTTGATATCCTTAGTAATCATGCTCGAGCATGATTACTAAGGATATCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)