EMAIL THIS PAGE TO A FRIEND

HTN3

histatin 3

29 Gene Product Result for
Synonyms: HIS2 HTN2 HTN5
Species: Human HTN3(3347)
UniProtKB ID: P15516, Q16243, Q502Z1
Gene ID:
Human(3347) Summary: This gene encodes a member of the histatin family of small, histidine-rich salivary proteins. Histatins exhibit non-immunological, anti-microbial activity in the oral cavity. [provided by RefSeq, May 2009]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1402234 Monoclonal Anti-HTN3 antibody produced in mouse clone 4G9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing

Proteins

Product # Description Species Add to Cart
 
H6027 Histatin 5 ≥97% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000200 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118381 MISSION® esiRNA esiRNA human HTN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000200 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174389 predicted 214
2 SASI_Hs01_00174390 predicted 287
3 SASI_Hs01_00174391 predicted 213
4 SASI_Hs01_00174394 predicted 278
5 SASI_Hs02_00302072 predicted 272
6 SASI_Hs01_00174395 predicted 211
7 SASI_Hs01_00174396 predicted 272
8 SASI_Hs01_00174397 predicted 280
9 SASI_Hs01_00174398 predicted 218
10 SASI_Hs02_00302073 predicted 273
11 SASI_Hs01_00174392 predicted 199
12 SASI_Hs01_00174393 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000200
HTN3 MISSION shRNA Bacterial Glycerol Stock
histatin 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000200.2-225s21c1
Sequence:CCGGGCATCATTCACATCGAGGCTACTCGAGTAGCCTCGATGTGAATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000200.2-321s21c1
Sequence:CCGGTTCGCTTTGGACTCGTGTATTCTCGAGAATACACGAGTCCAAAGCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000200.2-259s21c1
Sequence:CCGGCTGTATGACAATTGATATCTTCTCGAGAAGATATCAATTGTCATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000200.2-335s21c1
Sequence:CCGGGTGTATTCTCATTTGTCATACCTCGAGGTATGACAAATGAGAATACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000200.1-311s1c1
Sequence:CCGGGCATCACACTACCACTGCTTTCTCGAGAAAGCAGTGGTAGTGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000200.1-192s1c1
Sequence:CCGGCGAGGCTATAGATCAAATTATCTCGAGATAATTTGATCTATAGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000200.1-138s1c1
Sequence:CCGGGCAAAGAGACATCATGGGTATCTCGAGATACCCATGATGTCTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000200.1-117s1c1
Sequence:CCGGATGACTGGAGCTGATTCACATCTCGAGATGTGAATCAGCTCCAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000200
HTN3 MISSION shRNA shRNA Plasmid DNA
histatin 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000200.2-225s21c1
Sequence:CCGGGCATCATTCACATCGAGGCTACTCGAGTAGCCTCGATGTGAATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000200.2-321s21c1
Sequence:CCGGTTCGCTTTGGACTCGTGTATTCTCGAGAATACACGAGTCCAAAGCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000200.2-259s21c1
Sequence:CCGGCTGTATGACAATTGATATCTTCTCGAGAAGATATCAATTGTCATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000200.2-335s21c1
Sequence:CCGGGTGTATTCTCATTTGTCATACCTCGAGGTATGACAAATGAGAATACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000200.1-311s1c1
Sequence:CCGGGCATCACACTACCACTGCTTTCTCGAGAAAGCAGTGGTAGTGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000200.1-192s1c1
Sequence:CCGGCGAGGCTATAGATCAAATTATCTCGAGATAATTTGATCTATAGCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000200.1-138s1c1
Sequence:CCGGGCAAAGAGACATCATGGGTATCTCGAGATACCCATGATGTCTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000200.1-117s1c1
Sequence:CCGGATGACTGGAGCTGATTCACATCTCGAGATGTGAATCAGCTCCAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000200
HTN3 MISSION shRNA Lentiviral Transduction Particles
histatin 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000200.2-225s21c1
Sequence:CCGGGCATCATTCACATCGAGGCTACTCGAGTAGCCTCGATGTGAATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000200.2-321s21c1
Sequence:CCGGTTCGCTTTGGACTCGTGTATTCTCGAGAATACACGAGTCCAAAGCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000200.2-259s21c1
Sequence:CCGGCTGTATGACAATTGATATCTTCTCGAGAAGATATCAATTGTCATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000200.2-335s21c1
Sequence:CCGGGTGTATTCTCATTTGTCATACCTCGAGGTATGACAAATGAGAATACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118707    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000200.1-311s1c1
Sequence:CCGGGCATCACACTACCACTGCTTTCTCGAGAAAGCAGTGGTAGTGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000200.1-192s1c1
Sequence:CCGGCGAGGCTATAGATCAAATTATCTCGAGATAATTTGATCTATAGCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000200.1-138s1c1
Sequence:CCGGGCAAAGAGACATCATGGGTATCTCGAGATACCCATGATGTCTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000200.1-117s1c1
Sequence:CCGGATGACTGGAGCTGATTCACATCTCGAGATGTGAATCAGCTCCAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)