EMAIL THIS PAGE TO A FRIEND

HTR1A

5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled

126 Gene Product Result for
Synonyms: 5-HT-1A 5-HT1A 5HT1a ADRB2RL1 ADRBRL1 G-21 PFMCD
UniProtKB ID: P08908, Q6LAE7
Gene ID:
Human(3350) Summary: This gene encodes a G protein-coupled receptor for 5-hydroxytryptamine (serotonin), and belongs to the 5-hydroxytryptamine receptor subfamily. Serotonin has been implicated in a number of physiologic processes and pathologic conditions. Inactivation of this gene in mice results in behavior consistent with an increased anxiety and stress response. Mutation in the promoter of this gene has been associated with menstrual cycle-dependent periodic fevers. [provided by RefSeq, Jun 2012]
Mouse(15550) 5-hydroxytryptamine (serotonin) receptor 1A
Rat(24473) 5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
chicken(431581) 5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
Horse(100009683) 5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
cow(407137) 5-hydroxytryptamine (serotonin) receptor 1A
domestic cat(101101542) 5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
dog(487230) 5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
sheep(101105852) 5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
Domestic Rabbit(100008780) 5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
domestic guinea pig(100301563) 5-hydroxytryptamine (serotonin) receptor 1A
naked mole-rat(101718872) 5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P0884 (±)-Propranolol hydrochloride ≥99% (TLC), powder human pricing
P8688 (S)-(−)-Propranolol hydrochloride ≥98% (TLC), powder human pricing
M149 Methiothepin mesylate salt ≥98% (HPLC), solid human pricing
M137 Methysergide maleate salt solid human pricing
N3529 NAN-190 hydrobromide human pricing
M226 p-MPPF dihydrochloride solid human pricing
U108 S(−)-UH-301 hydrochloride solid human pricing
W108 WAY-100635 maleate salt powder human pricing
A0132 Atropine ≥99% (TLC), powder human, mouse, rat pricing
A2468 Atropine meets USP testing specifications human, mouse, rat pricing
M0443 Mirtazapine ≥98% (HPLC) human, mouse, rat pricing
S7771 (S)-(−)-Sulpiride ≥98% (titration) human, rat pricing
T13005 1,2,3,4-Tetrahydroisoquinoline 95% human, rat pricing
38827 4,4′-Dimethoxytriphenylmethyl chloride ≥97.0% (HPLC) human, rat pricing
286583 5-Methoxytryptamine 97% human, rat pricing
M1626 6-Methoxyharmalan crystalline human, rat pricing
B9308 BP897 >98% (HPLC), solid human, rat pricing
C6305 Clozapine human, rat pricing
H1512 Haloperidol powder human, rat pricing
51330 Harmaline ≥95% human, rat pricing
L7007 Lysergic acid diethylamide human, rat pricing
M2017 Mazindol ≥98% (TLC), powder human, rat pricing
M3668 Metergoline human, rat pricing
65372 O-Methylserotonin purum, ≥98.0% (NT) human, rat pricing
P2279 Psilocin human, rat pricing
P4054 Psilocin solution 100 μg/mL in methanol, drug standard human, rat pricing
R103 Ritanserin powder human, rat pricing
S0693 SB 204741 >98% (HPLC) human, rat pricing
S7395 Spiperone solid human, rat pricing
T104 Tropisetron monohydrochloride solid, ≥98% (HPLC) human, rat pricing
M22601 1-(2-Methoxyphenyl)piperazine 98% mouse, rat pricing
571415 1-(4-Methoxyphenyl)piperazine 97% mouse, rat pricing
T9073 1-(α,α,α-Trifluoro-m-tolyl)piperazine analytical standard, 96% mouse, rat pricing
75475 1-Cyclohexylpiperazine ≥97.0% (GC) mouse, rat pricing
P30004 1-Phenylpiperazine 99% mouse, rat pricing
125180 1-(3-Chlorophenyl)piperazine hydrochloride 99% rat pricing
471682 1-(3-Methoxyphenyl)piperazine 95% rat pricing
79224 1-Phenyl-1,3,8-triazaspiro[4.5]decan-4-one ≥96.0% (HPLC) rat pricing
G0544 GR 103691 ≥98% (HPLC), solid rat pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
M2381 5-Methoxy-N,N-dimethyltryptamine human, rat pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008308 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008308 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008308 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000524 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000524 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000524 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118601 MISSION® esiRNA esiRNA human HTR1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000524 Rosetta Predictions human pricing
NM_012585 Rosetta Predictions rat pricing
NM_008308 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000524 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074693 predicted 310
2 SASI_Hs01_00074694 predicted 564
3 SASI_Hs01_00074695 predicted 201
4 SASI_Hs02_00302724 predicted 632
5 SASI_Hs01_00074696 predicted 274
6 SASI_Hs01_00074697 predicted 202
7 SASI_Hs01_00074698 predicted 241
8 SASI_Hs01_00074699 predicted 196
9 SASI_Hs01_00074700 predicted 577
10 SASI_Hs01_00074701 predicted 829
11 SASI_Hs01_00074702 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074186 predicted 473
2 SASI_Rn01_00074187 predicted 231
3 SASI_Rn01_00074188 predicted 655
4 SASI_Rn01_00074189 predicted 592
5 SASI_Rn01_00074190 predicted 404
6 SASI_Rn01_00074191 predicted 399
7 SASI_Rn01_00074192 predicted 409
8 SASI_Rn01_00074193 predicted 228
9 SASI_Rn01_00074194 predicted 402
10 SASI_Rn01_00074195 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008308 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197594 predicted 1437
2 SASI_Mm01_00197595 predicted 751
3 SASI_Mm01_00197596 predicted 2149
4 SASI_Mm01_00197597 predicted 2091
5 SASI_Mm01_00197598 predicted 2119
6 SASI_Mm01_00197599 predicted 949
7 SASI_Mm01_00197600 predicted 977
8 SASI_Mm01_00197601 predicted 901
9 SASI_Mm01_00197602 predicted 959
10 SASI_Mm01_00197603 predicted 1431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008308
HTR1A MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-880s21c1
Sequence:CCGGGTCACCTGTGACCTGTTTATCCTCGAGGATAAACAGGTCACAGGTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008308.4-3457s21c1
Sequence:CCGGCTAAGTGAGAGGGCATCAAATCTCGAGATTTGATGCCCTCTCACTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-1670s1c1
Sequence:CCGGCCCTGCTCAACCCAGTTATTTCTCGAGAAATAACTGGGTTGAGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-1235s21c1
Sequence:CCGGGAATCCGCAAGACGGTCAAGACTCGAGTCTTGACCGTCTTGCGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-1624s1c1
Sequence:CCGGCCTGAGTTGTTGGGTGCCATACTCGAGTATGGCACCCAACAACTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-1074s1c1
Sequence:CCGGGTACACCATCTACTCCACTTTCTCGAGAAAGTGGAGTAGATGGTGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-909s1c1
Sequence:CCGGCGACCCTATAGACTACGTGAACTCGAGTTCACGTAGTCTATAGGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008308.2-1843s1c1
Sequence:CCGGCCCTTCCTGTTCACTCAATATCTCGAGATATTGAGTGAACAGGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-1031s21c1
Sequence:CCGGTCTCGCTCACTTGGCTCATTGCTCGAGCAATGAGCCAAGTGAGCGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-761s21c1
Sequence:CCGGTTCAGAATGTTGCCAACTATCCTCGAGGATAGTTGGCAACATTCTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008308
HTR1A MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-880s21c1
Sequence:CCGGGTCACCTGTGACCTGTTTATCCTCGAGGATAAACAGGTCACAGGTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008308.4-3457s21c1
Sequence:CCGGCTAAGTGAGAGGGCATCAAATCTCGAGATTTGATGCCCTCTCACTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-1670s1c1
Sequence:CCGGCCCTGCTCAACCCAGTTATTTCTCGAGAAATAACTGGGTTGAGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-1235s21c1
Sequence:CCGGGAATCCGCAAGACGGTCAAGACTCGAGTCTTGACCGTCTTGCGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-1624s1c1
Sequence:CCGGCCTGAGTTGTTGGGTGCCATACTCGAGTATGGCACCCAACAACTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-1074s1c1
Sequence:CCGGGTACACCATCTACTCCACTTTCTCGAGAAAGTGGAGTAGATGGTGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-909s1c1
Sequence:CCGGCGACCCTATAGACTACGTGAACTCGAGTTCACGTAGTCTATAGGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008308.2-1843s1c1
Sequence:CCGGCCCTTCCTGTTCACTCAATATCTCGAGATATTGAGTGAACAGGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-1031s21c1
Sequence:CCGGTCTCGCTCACTTGGCTCATTGCTCGAGCAATGAGCCAAGTGAGCGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-761s21c1
Sequence:CCGGTTCAGAATGTTGCCAACTATCCTCGAGGATAGTTGGCAACATTCTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008308
HTR1A MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-880s21c1
Sequence:CCGGGTCACCTGTGACCTGTTTATCCTCGAGGATAAACAGGTCACAGGTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008308.4-3457s21c1
Sequence:CCGGCTAAGTGAGAGGGCATCAAATCTCGAGATTTGATGCCCTCTCACTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-1670s1c1
Sequence:CCGGCCCTGCTCAACCCAGTTATTTCTCGAGAAATAACTGGGTTGAGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-1235s21c1
Sequence:CCGGGAATCCGCAAGACGGTCAAGACTCGAGTCTTGACCGTCTTGCGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-1624s1c1
Sequence:CCGGCCTGAGTTGTTGGGTGCCATACTCGAGTATGGCACCCAACAACTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-1074s1c1
Sequence:CCGGGTACACCATCTACTCCACTTTCTCGAGAAAGTGGAGTAGATGGTGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008308.2-909s1c1
Sequence:CCGGCGACCCTATAGACTACGTGAACTCGAGTTCACGTAGTCTATAGGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008308.2-1843s1c1
Sequence:CCGGCCCTTCCTGTTCACTCAATATCTCGAGATATTGAGTGAACAGGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-1031s21c1
Sequence:CCGGTCTCGCTCACTTGGCTCATTGCTCGAGCAATGAGCCAAGTGAGCGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008308.4-761s21c1
Sequence:CCGGTTCAGAATGTTGCCAACTATCCTCGAGGATAGTTGGCAACATTCTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000524
HTR1A MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-949s1c1
Sequence:CCGGCCCGCCTCTTTCGAGAGGAAACTCGAGTTTCCTCTCGAAAGAGGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-212s1c1
Sequence:CCGGCCAATTATCTTATTGGCTCTTCTCGAGAAGAGCCAATAAGATAATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-632s1c1
Sequence:CCGGTGGTTCTCTATGGGCGCATATCTCGAGATATGCGCCCATAGAGAACCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-566s1c1
Sequence:CCGGGCAAGGATCATGGCTACACTACTCGAGTAGTGTAGCCATGATCCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000524.2-200s21c1
Sequence:CCGGTGCAGAACGTGGCCAATTATCCTCGAGGATAATTGGCCACGTTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000524.2-636s21c1
Sequence:CCGGGGTTCTCTATGGGCGCATATTCTCGAGAATATGCGCCCATAGAGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000524.2-575s21c1
Sequence:CCGGATCATGGCTACACTATCTATTCTCGAGAATAGATAGTGTAGCCATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000524
HTR1A MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-949s1c1
Sequence:CCGGCCCGCCTCTTTCGAGAGGAAACTCGAGTTTCCTCTCGAAAGAGGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-212s1c1
Sequence:CCGGCCAATTATCTTATTGGCTCTTCTCGAGAAGAGCCAATAAGATAATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-632s1c1
Sequence:CCGGTGGTTCTCTATGGGCGCATATCTCGAGATATGCGCCCATAGAGAACCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-566s1c1
Sequence:CCGGGCAAGGATCATGGCTACACTACTCGAGTAGTGTAGCCATGATCCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000524.2-200s21c1
Sequence:CCGGTGCAGAACGTGGCCAATTATCCTCGAGGATAATTGGCCACGTTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000524.2-636s21c1
Sequence:CCGGGGTTCTCTATGGGCGCATATTCTCGAGAATATGCGCCCATAGAGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000524.2-575s21c1
Sequence:CCGGATCATGGCTACACTATCTATTCTCGAGAATAGATAGTGTAGCCATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000524
HTR1A MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-949s1c1
Sequence:CCGGCCCGCCTCTTTCGAGAGGAAACTCGAGTTTCCTCTCGAAAGAGGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-212s1c1
Sequence:CCGGCCAATTATCTTATTGGCTCTTCTCGAGAAGAGCCAATAAGATAATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-632s1c1
Sequence:CCGGTGGTTCTCTATGGGCGCATATCTCGAGATATGCGCCCATAGAGAACCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000524.1-566s1c1
Sequence:CCGGGCAAGGATCATGGCTACACTACTCGAGTAGTGTAGCCATGATCCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000524.2-200s21c1
Sequence:CCGGTGCAGAACGTGGCCAATTATCCTCGAGGATAATTGGCCACGTTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000524.2-636s21c1
Sequence:CCGGGGTTCTCTATGGGCGCATATTCTCGAGAATATGCGCCCATAGAGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000524.2-575s21c1
Sequence:CCGGATCATGGCTACACTATCTATTCTCGAGAATAGATAGTGTAGCCATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)