EMAIL THIS PAGE TO A FRIEND

HTR1B

5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled

96 Gene Product Result for
Synonyms: 5-HT1B 5-HT1DB HTR1D2 HTR1DB S12
UniProtKB ID: P28222, Q4VAY7
Gene ID:
Human(3351) Summary: The neurotransmitter serotonin (5-hydroxytryptamine; 5-HT) exerts a wide variety of physiologic functions through a multiplicity of receptors and may be involved in human neuropsychiatric disorders such as anxiety, depression, or migraine. These receptors consist of several main groups subdivided into several distinct subtypes on the basis of their pharmacologic characteristics, coupling to intracellular second messengers, and distribution within the nervous system (Zifa and Fillion, 1992 [PubMed 1359584]
Mouse(15551) 5-hydroxytryptamine (serotonin) receptor 1B
Rat(25075) 5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
Zebrafish(561647) 5-hydroxytryptamine (serotonin) receptor 1B
cow(317707) 5-hydroxytryptamine (serotonin) receptor 1B
Horse(100009680) 5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
domestic cat(100144391) 5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
dog(403741) 5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
chicken(421858) 5-hydroxytryptamine (serotonin) receptor 1B
domestic guinea pig(100135543) 5-hydroxytryptamine (serotonin) receptor 1B
sheep(101111375) 5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
Domestic Rabbit(100009594) 5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000863 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU044151 MISSION® esiRNA esiRNA targeting mouse Htr1b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000863 Rosetta Predictions human pricing
NM_022225 Rosetta Predictions rat pricing
NM_010482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069864 predicted 610
2 SASI_Hs01_00069865 predicted 931
3 SASI_Hs01_00069866 predicted 216
4 SASI_Hs01_00069867 predicted 305
5 SASI_Hs01_00069868 predicted 932
6 SASI_Hs01_00069869 predicted 447
7 SASI_Hs01_00069870 predicted 486
8 SASI_Hs01_00069871 predicted 533
9 SASI_Hs01_00069872 predicted 851
10 SASI_Hs01_00069873 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022225 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119236 predicted 517
2 SASI_Rn01_00119237 predicted 913
3 SASI_Rn01_00119238 predicted 203
4 SASI_Rn01_00119239 predicted 661
5 SASI_Rn01_00119240 predicted 429
6 SASI_Rn01_00119241 predicted 504
7 SASI_Rn01_00119242 predicted 260
8 SASI_Rn01_00119243 predicted 762
9 SASI_Rn02_00262989 predicted 816
10 SASI_Rn01_00119245 predicted 532
11 SASI_Rn01_00119244 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051439 predicted 661
2 SASI_Mm01_00051440 predicted 915
3 SASI_Mm01_00051441 predicted 838
4 SASI_Mm01_00051442 predicted 520
5 SASI_Mm01_00051443 predicted 867
6 SASI_Mm01_00051444 predicted 916
7 SASI_Mm01_00051445 predicted 484
8 SASI_Mm02_00318717 predicted 540
9 SASI_Mm01_00051446 predicted 917
10 SASI_Mm01_00051447 predicted 735
11 SASI_Mm01_00051448 predicted 776
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000863
HTR1B MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-938s21c1
Sequence:CCGGCCAAGACCCTAGGGATCATTTCTCGAGAAATGATCCCTAGGGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-57s21c1
Sequence:CCGGGGTTCCTCAAGCCAACTTATCCTCGAGGATAAGTTGGCTTGAGGAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-147s21c1
Sequence:CCGGAGTACTGCTGGTTATGCTATTCTCGAGAATAGCATAACCAGCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-792s21c1
Sequence:CCGGGTCCTCGGTCACCTCTATTAACTCGAGTTAATAGAGGTGACCGAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-964s1c1
Sequence:CCGGGCCTTTATTGTGTGTTGGCTACTCGAGTAGCCAACACACAATAAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-853s1c1
Sequence:CCGGGTGTATGTGAACCAAGTCAAACTCGAGTTTGACTTGGTTCACATACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-204s1c1
Sequence:CCGGCTTTGTGATTGCCACAGTGTACTCGAGTACACTGTGGCAATCACAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-802s1c1
Sequence:CCGGACCTCTATTAACTCGCGGGTTCTCGAGAACCCGCGAGTTAATAGAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-102s1c1
Sequence:CCGGCGCCAAGGACTACATTTACCACTCGAGTGGTAAATGTAGTCCTTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000863
HTR1B MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-938s21c1
Sequence:CCGGCCAAGACCCTAGGGATCATTTCTCGAGAAATGATCCCTAGGGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-57s21c1
Sequence:CCGGGGTTCCTCAAGCCAACTTATCCTCGAGGATAAGTTGGCTTGAGGAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-147s21c1
Sequence:CCGGAGTACTGCTGGTTATGCTATTCTCGAGAATAGCATAACCAGCAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-792s21c1
Sequence:CCGGGTCCTCGGTCACCTCTATTAACTCGAGTTAATAGAGGTGACCGAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-964s1c1
Sequence:CCGGGCCTTTATTGTGTGTTGGCTACTCGAGTAGCCAACACACAATAAAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-853s1c1
Sequence:CCGGGTGTATGTGAACCAAGTCAAACTCGAGTTTGACTTGGTTCACATACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-204s1c1
Sequence:CCGGCTTTGTGATTGCCACAGTGTACTCGAGTACACTGTGGCAATCACAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-802s1c1
Sequence:CCGGACCTCTATTAACTCGCGGGTTCTCGAGAACCCGCGAGTTAATAGAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-102s1c1
Sequence:CCGGCGCCAAGGACTACATTTACCACTCGAGTGGTAAATGTAGTCCTTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000863
HTR1B MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-938s21c1
Sequence:CCGGCCAAGACCCTAGGGATCATTTCTCGAGAAATGATCCCTAGGGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-57s21c1
Sequence:CCGGGGTTCCTCAAGCCAACTTATCCTCGAGGATAAGTTGGCTTGAGGAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-147s21c1
Sequence:CCGGAGTACTGCTGGTTATGCTATTCTCGAGAATAGCATAACCAGCAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000863.1-792s21c1
Sequence:CCGGGTCCTCGGTCACCTCTATTAACTCGAGTTAATAGAGGTGACCGAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-964s1c1
Sequence:CCGGGCCTTTATTGTGTGTTGGCTACTCGAGTAGCCAACACACAATAAAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-853s1c1
Sequence:CCGGGTGTATGTGAACCAAGTCAAACTCGAGTTTGACTTGGTTCACATACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-204s1c1
Sequence:CCGGCTTTGTGATTGCCACAGTGTACTCGAGTACACTGTGGCAATCACAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-802s1c1
Sequence:CCGGACCTCTATTAACTCGCGGGTTCTCGAGAACCCGCGAGTTAATAGAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000863.1-102s1c1
Sequence:CCGGCGCCAAGGACTACATTTACCACTCGAGTGGTAAATGTAGTCCTTGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010482
HTR1B MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-185s1c1
Sequence:CCGGCCAACGCCTTTGTAATCGCTACTCGAGTAGCGATTACAAAGGCGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-535s1c1
Sequence:CCGGCCACCCTTCTTCTGGCGTCAACTCGAGTTGACGCCAGAAGAAGGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-448s1c1
Sequence:CCGGGCGGTGGAGTATTCTGCTAAACTCGAGTTTAGCAGAATACTCCACCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-841s1c1
Sequence:CCGGGTGTACGTGAACCAAGTCAAACTCGAGTTTGACTTGGTTCACGTACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-990s1c1
Sequence:CCGGCCTGGTGATGCCTATCTGTAACTCGAGTTACAGATAGGCATCACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010482
HTR1B MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-185s1c1
Sequence:CCGGCCAACGCCTTTGTAATCGCTACTCGAGTAGCGATTACAAAGGCGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-535s1c1
Sequence:CCGGCCACCCTTCTTCTGGCGTCAACTCGAGTTGACGCCAGAAGAAGGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-448s1c1
Sequence:CCGGGCGGTGGAGTATTCTGCTAAACTCGAGTTTAGCAGAATACTCCACCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-841s1c1
Sequence:CCGGGTGTACGTGAACCAAGTCAAACTCGAGTTTGACTTGGTTCACGTACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-990s1c1
Sequence:CCGGCCTGGTGATGCCTATCTGTAACTCGAGTTACAGATAGGCATCACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010482
HTR1B MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025768    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-185s1c1
Sequence:CCGGCCAACGCCTTTGTAATCGCTACTCGAGTAGCGATTACAAAGGCGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-535s1c1
Sequence:CCGGCCACCCTTCTTCTGGCGTCAACTCGAGTTGACGCCAGAAGAAGGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-448s1c1
Sequence:CCGGGCGGTGGAGTATTCTGCTAAACTCGAGTTTAGCAGAATACTCCACCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-841s1c1
Sequence:CCGGGTGTACGTGAACCAAGTCAAACTCGAGTTTGACTTGGTTCACGTACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010482.1-990s1c1
Sequence:CCGGCCTGGTGATGCCTATCTGTAACTCGAGTTACAGATAGGCATCACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)