EMAIL THIS PAGE TO A FRIEND

HTR1D

5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled

128 Gene Product Result for
Synonyms: 5-HT1D HT1DA HTR1DA HTRL RDC4
UniProtKB ID: P28221
Gene ID:
Mouse(15552) 5-hydroxytryptamine (serotonin) receptor 1D
Rat(25323) 5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
chicken(769107) 5-hydroxytryptamine (serotonin) receptor 1D
dog(403963) 5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
cow(407136) 5-hydroxytryptamine (serotonin) receptor 1D
domestic cat(101097077) 5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
sheep(101122172) 5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
Domestic Rabbit(100328964) 5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
domestic guinea pig(100379622) 5-hydroxytryptamine (serotonin) receptor 1D
naked mole-rat(101708206) 5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008309 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008309 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008309 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000864 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000864 Rosetta Predictions human pricing
NM_012852 Rosetta Predictions rat pricing
NM_008309 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147192 predicted 1368
2 SASI_Hs01_00147193 predicted 1206
3 SASI_Hs01_00147195 predicted 812
4 SASI_Hs01_00147196 predicted 982
5 SASI_Hs01_00147197 predicted 817
6 SASI_Hs02_00303389 predicted 670
7 SASI_Hs01_00147198 predicted 663
8 SASI_Hs01_00147199 predicted 1456
9 SASI_Hs02_00303390 predicted 827
10 SASI_Hs01_00147200 predicted 686
11 SASI_Hs01_00147194 predicted 1083
12 SASI_Hs01_00147201 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012852 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109834 predicted 855
2 SASI_Rn01_00109835 predicted 834
3 SASI_Rn01_00109836 predicted 682
4 SASI_Rn01_00109837 predicted 884
5 SASI_Rn01_00109838 predicted 615
6 SASI_Rn01_00109839 predicted 559
7 SASI_Rn01_00109840 predicted 247
8 SASI_Rn01_00109841 predicted 263
9 SASI_Rn01_00109842 predicted 527
10 SASI_Rn01_00109843 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008309 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313620 predicted 1584
2 SASI_Mm01_00190081 predicted 1524
3 SASI_Mm01_00190082 predicted 1437
4 SASI_Mm01_00190083 predicted 2064
5 SASI_Mm01_00190084 predicted 1571
6 SASI_Mm01_00190085 predicted 1575
7 SASI_Mm01_00190086 predicted 1529
8 SASI_Mm02_00313621 predicted 1218
9 SASI_Mm01_00190087 predicted 1796
10 SASI_Mm01_00190088 predicted 1875
11 SASI_Mm01_00190089 predicted 1355
12 SASI_Mm01_00190090 predicted 2186
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008309
HTR1D MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000028393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008309.2-1574s1c1
Sequence:CCGGCGCCTTCTATATCCCATCCATCTCGAGATGGATGGGATATAGAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008309.2-1844s1c1
Sequence:CCGGCCGAGAAAGGAAAGCCACTAACTCGAGTTAGTGGCTTTCCTTTCTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008309.2-2188s1c1
Sequence:CCGGCGGGTTGATTTGTGCTATCTTCTCGAGAAGATAGCACAAATCAACCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008309.2-2058s1c1
Sequence:CCGGGCGTTTCAGAAAGTCGTCCATCTCGAGATGGACGACTTTCTGAAACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008309
HTR1D MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000028393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008309.2-1574s1c1
Sequence:CCGGCGCCTTCTATATCCCATCCATCTCGAGATGGATGGGATATAGAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008309.2-1844s1c1
Sequence:CCGGCCGAGAAAGGAAAGCCACTAACTCGAGTTAGTGGCTTTCCTTTCTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008309.2-2188s1c1
Sequence:CCGGCGGGTTGATTTGTGCTATCTTCTCGAGAAGATAGCACAAATCAACCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008309.2-2058s1c1
Sequence:CCGGGCGTTTCAGAAAGTCGTCCATCTCGAGATGGACGACTTTCTGAAACGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008309
HTR1D MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000028393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008309.2-1574s1c1
Sequence:CCGGCGCCTTCTATATCCCATCCATCTCGAGATGGATGGGATATAGAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008309.2-1844s1c1
Sequence:CCGGCCGAGAAAGGAAAGCCACTAACTCGAGTTAGTGGCTTTCCTTTCTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008309.2-2188s1c1
Sequence:CCGGCGGGTTGATTTGTGCTATCTTCTCGAGAAGATAGCACAAATCAACCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008309.2-2058s1c1
Sequence:CCGGGCGTTTCAGAAAGTCGTCCATCTCGAGATGGACGACTTTCTGAAACGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000864
HTR1D MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-1567s1c1
Sequence:CCGGCCAATAATCTACACTGTGTTTCTCGAGAAACACAGTGTAGATTATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-759s1c1
Sequence:CCGGCGACCTCTTGGTTTCCATCTTCTCGAGAAGATGGAAACCAAGAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-681s1c1
Sequence:CCGGCTTTGTACTCACCACCATCTTCTCGAGAAGATGGTGGTGAGTACAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-938s1c1
Sequence:CCGGCCCTGGAATACAGTAAACGCACTCGAGTGCGTTTACTGTATTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-1141s1c1
Sequence:CCGGGTGTTGCTCATCATCCTATATCTCGAGATATAGGATGATGAGCAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-1630s21c1
Sequence:CCGGCGGAAGGCCTCCTAGTCTTATCTCGAGATAAGACTAGGAGGCCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-1531s21c1
Sequence:CCGGTTCACCTGGCTAGGCTATTTACTCGAGTAAATAGCCTAGCCAGGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-785s21c1
Sequence:CCGGTGCCCATCAGCATCGCCTATACTCGAGTATAGGCGATGCTGATGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-1142s21c1
Sequence:CCGGTGTTGCTCATCATCCTATATGCTCGAGCATATAGGATGATGAGCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000864
HTR1D MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-1567s1c1
Sequence:CCGGCCAATAATCTACACTGTGTTTCTCGAGAAACACAGTGTAGATTATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-759s1c1
Sequence:CCGGCGACCTCTTGGTTTCCATCTTCTCGAGAAGATGGAAACCAAGAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-681s1c1
Sequence:CCGGCTTTGTACTCACCACCATCTTCTCGAGAAGATGGTGGTGAGTACAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-938s1c1
Sequence:CCGGCCCTGGAATACAGTAAACGCACTCGAGTGCGTTTACTGTATTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-1141s1c1
Sequence:CCGGGTGTTGCTCATCATCCTATATCTCGAGATATAGGATGATGAGCAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-1630s21c1
Sequence:CCGGCGGAAGGCCTCCTAGTCTTATCTCGAGATAAGACTAGGAGGCCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-1531s21c1
Sequence:CCGGTTCACCTGGCTAGGCTATTTACTCGAGTAAATAGCCTAGCCAGGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-785s21c1
Sequence:CCGGTGCCCATCAGCATCGCCTATACTCGAGTATAGGCGATGCTGATGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-1142s21c1
Sequence:CCGGTGTTGCTCATCATCCTATATGCTCGAGCATATAGGATGATGAGCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000864
HTR1D MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 1D, G protein-coupled
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-1567s1c1
Sequence:CCGGCCAATAATCTACACTGTGTTTCTCGAGAAACACAGTGTAGATTATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-759s1c1
Sequence:CCGGCGACCTCTTGGTTTCCATCTTCTCGAGAAGATGGAAACCAAGAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-681s1c1
Sequence:CCGGCTTTGTACTCACCACCATCTTCTCGAGAAGATGGTGGTGAGTACAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-938s1c1
Sequence:CCGGCCCTGGAATACAGTAAACGCACTCGAGTGCGTTTACTGTATTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000864.3-1141s1c1
Sequence:CCGGGTGTTGCTCATCATCCTATATCTCGAGATATAGGATGATGAGCAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-1630s21c1
Sequence:CCGGCGGAAGGCCTCCTAGTCTTATCTCGAGATAAGACTAGGAGGCCTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-1531s21c1
Sequence:CCGGTTCACCTGGCTAGGCTATTTACTCGAGTAAATAGCCTAGCCAGGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-785s21c1
Sequence:CCGGTGCCCATCAGCATCGCCTATACTCGAGTATAGGCGATGCTGATGGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000864.4-1142s21c1
Sequence:CCGGTGTTGCTCATCATCCTATATGCTCGAGCATATAGGATGATGAGCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)