EMAIL THIS PAGE TO A FRIEND

HTR1E

5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled

71 Gene Product Result for
Synonyms: 5-HT1E
UniProtKB ID: P28566, E1P503, Q9P1Y1
Gene ID:
Mouse(107927) 5-hydroxytryptamine (serotonin) receptor 1E
chicken(771973) 5-hydroxytryptamine (serotonin) receptor 1E
cow(616356) 5-hydroxytryptamine (serotonin) receptor 1E
domestic cat(101088489) 5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled
dog(481907) 5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled
sheep(101114783) 5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled
domestic guinea pig(100379275) 5-hydroxytryptamine (serotonin) receptor 1E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000865 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000865 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303391 predicted 1153
2 SASI_Hs01_00076752 predicted 1091
3 SASI_Hs01_00076753 predicted 1439
4 SASI_Hs01_00076754 predicted 1155
5 SASI_Hs01_00076755 predicted 866
6 SASI_Hs01_00076756 predicted 1175
7 SASI_Hs01_00076757 predicted 684
8 SASI_Hs01_00076758 predicted 834
9 SASI_Hs01_00076760 predicted 1237
10 SASI_Hs01_00076761 predicted 621
11 SASI_Hs01_00076759 predicted 1099
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000865
HTR1E MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000865.2-1236s21c1
Sequence:CCGGACCATGTTATCTACACCATTTCTCGAGAAATGGTGTAGATAACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000865.2-1301s21c1
Sequence:CCGGATTCTCTATTACCGGATTTACCTCGAGGTAAATCCGGTAATAGAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1100s1c1
Sequence:CCGGCCATGTTATCTACACCATTTACTCGAGTAAATGGTGTAGATAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1365s1c1
Sequence:CCGGCCCTTCGACAATGATCTAGATCTCGAGATCTAGATCATTGTCGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-677s1c1
Sequence:CCGGGTTGCTGAACTTGGCTGTGATCTCGAGATCACAGCCAAGTTCAGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1163s1c1
Sequence:CCGGGATTCTCTATTACCGGATTTACTCGAGTAAATCCGGTAATAGAGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1586s1c1
Sequence:CCGGCCCTCTGCTCTATACGAGTTTCTCGAGAAACTCGTATAGAGCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000865.2-1781s21c1
Sequence:CCGGAGATGCCGAGAGCATACTTAGCTCGAGCTAAGTATGCTCTCGGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000865
HTR1E MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000865.2-1236s21c1
Sequence:CCGGACCATGTTATCTACACCATTTCTCGAGAAATGGTGTAGATAACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000865.2-1301s21c1
Sequence:CCGGATTCTCTATTACCGGATTTACCTCGAGGTAAATCCGGTAATAGAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1100s1c1
Sequence:CCGGCCATGTTATCTACACCATTTACTCGAGTAAATGGTGTAGATAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1365s1c1
Sequence:CCGGCCCTTCGACAATGATCTAGATCTCGAGATCTAGATCATTGTCGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-677s1c1
Sequence:CCGGGTTGCTGAACTTGGCTGTGATCTCGAGATCACAGCCAAGTTCAGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1163s1c1
Sequence:CCGGGATTCTCTATTACCGGATTTACTCGAGTAAATCCGGTAATAGAGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1586s1c1
Sequence:CCGGCCCTCTGCTCTATACGAGTTTCTCGAGAAACTCGTATAGAGCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000865.2-1781s21c1
Sequence:CCGGAGATGCCGAGAGCATACTTAGCTCGAGCTAAGTATGCTCTCGGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000865
HTR1E MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000865.2-1236s21c1
Sequence:CCGGACCATGTTATCTACACCATTTCTCGAGAAATGGTGTAGATAACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000865.2-1301s21c1
Sequence:CCGGATTCTCTATTACCGGATTTACCTCGAGGTAAATCCGGTAATAGAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1100s1c1
Sequence:CCGGCCATGTTATCTACACCATTTACTCGAGTAAATGGTGTAGATAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1365s1c1
Sequence:CCGGCCCTTCGACAATGATCTAGATCTCGAGATCTAGATCATTGTCGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-677s1c1
Sequence:CCGGGTTGCTGAACTTGGCTGTGATCTCGAGATCACAGCCAAGTTCAGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1163s1c1
Sequence:CCGGGATTCTCTATTACCGGATTTACTCGAGTAAATCCGGTAATAGAGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000865.1-1586s1c1
Sequence:CCGGCCCTCTGCTCTATACGAGTTTCTCGAGAAACTCGTATAGAGCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000865.2-1781s21c1
Sequence:CCGGAGATGCCGAGAGCATACTTAGCTCGAGCTAAGTATGCTCTCGGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)