EMAIL THIS PAGE TO A FRIEND

HTR1F

5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled

97 Gene Product Result for
Synonyms: 5-HT-1F 5-HT1F 5HT6 HTR1EL MR77
UniProtKB ID: P30939
Gene ID:
Mouse(15557) 5-hydroxytryptamine (serotonin) receptor 1F
Rat(60448) 5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
domestic guinea pig(100135544) 5-hydroxytryptamine (serotonin) receptor 1F
naked mole-rat(101718952) 5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
domestic guinea pig(100716637) 5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
sheep(101121647) 5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
Domestic Rabbit(100345520) 5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
chicken(427963) 5-hydroxytryptamine (serotonin) receptor 1F
dog(100683938) 5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
domestic cat(101100323) 5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
cow(407196) 5-hydroxytryptamine (serotonin) receptor 1F
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
M1514 Nω-Methyl-5-hydroxy­trypt­amine oxalate salt ≥90% (HPLC) human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_359054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_359054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_359054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000866 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000866 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000866 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008310 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008310 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008310 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000866 Rosetta Predictions human pricing
NM_021857 Rosetta Predictions rat pricing
NM_008310 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303392 predicted 1185
2 SASI_Hs01_00011789 predicted 686
3 SASI_Hs02_00303393 predicted 1170
4 SASI_Hs02_00303394 predicted 1035
5 SASI_Hs01_00011790 predicted 499
6 SASI_Hs01_00011791 predicted 436
7 SASI_Hs01_00011792 predicted 820
8 SASI_Hs01_00011793 predicted 528
9 SASI_Hs02_00303395 predicted 1123
10 SASI_Hs01_00011794 predicted 868
11 SASI_Hs01_00011788 predicted 649
12 SASI_Hs01_00011795 predicted 242
13 SASI_Hs01_00011796 predicted 435
14 SASI_Hs01_00011797 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045033 predicted 797
2 SASI_Rn02_00262884 predicted 223
3 SASI_Rn01_00045034 predicted 216
4 SASI_Rn01_00045035 predicted 757
5 SASI_Rn01_00045036 predicted 498
6 SASI_Rn01_00045037 predicted 628
7 SASI_Rn01_00045038 predicted 559
8 SASI_Rn01_00045039 predicted 337
9 SASI_Rn01_00045040 predicted 420
10 SASI_Rn01_00045041 predicted 227
11 SASI_Rn01_00045042 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008310 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084545 predicted 1328
2 SASI_Mm01_00084546 predicted 1381
3 SASI_Mm01_00084547 predicted 1186
4 SASI_Mm01_00084548 predicted 573
5 SASI_Mm01_00084549 predicted 1003
6 SASI_Mm01_00084550 predicted 1196
7 SASI_Mm01_00084551 predicted 870
8 SASI_Mm01_00084552 predicted 632
9 SASI_Mm01_00084553 predicted 584
10 SASI_Mm01_00084554 predicted 652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_359054
HTR1F MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-576s1c1
Sequence:CCGGCCCGCTTGTATTGATATTGATCTCGAGATCAATATCAATACAAGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-231s1c1
Sequence:CCGGGCCCTTCAGTATTGTGTACATCTCGAGATGTACACAATACTGAAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-438s1c1
Sequence:CCGGCGTGTGGGTTATATCTGTGTTCTCGAGAACACAGATATAACCCACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-565s1c1
Sequence:CCGGGCTTTCTACATCCCGCTTGTACTCGAGTACAAGCGGGATGTAGAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-371s1c1
Sequence:CCGGCCATCACAGATGCAGTTGAATCTCGAGATTCAACTGCATCTGTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_359054
HTR1F MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-576s1c1
Sequence:CCGGCCCGCTTGTATTGATATTGATCTCGAGATCAATATCAATACAAGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-231s1c1
Sequence:CCGGGCCCTTCAGTATTGTGTACATCTCGAGATGTACACAATACTGAAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-438s1c1
Sequence:CCGGCGTGTGGGTTATATCTGTGTTCTCGAGAACACAGATATAACCCACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-565s1c1
Sequence:CCGGGCTTTCTACATCCCGCTTGTACTCGAGTACAAGCGGGATGTAGAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-371s1c1
Sequence:CCGGCCATCACAGATGCAGTTGAATCTCGAGATTCAACTGCATCTGTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_359054
HTR1F MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-576s1c1
Sequence:CCGGCCCGCTTGTATTGATATTGATCTCGAGATCAATATCAATACAAGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-231s1c1
Sequence:CCGGGCCCTTCAGTATTGTGTACATCTCGAGATGTACACAATACTGAAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-438s1c1
Sequence:CCGGCGTGTGGGTTATATCTGTGTTCTCGAGAACACAGATATAACCCACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-565s1c1
Sequence:CCGGGCTTTCTACATCCCGCTTGTACTCGAGTACAAGCGGGATGTAGAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_359054.1-371s1c1
Sequence:CCGGCCATCACAGATGCAGTTGAATCTCGAGATTCAACTGCATCTGTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000866
HTR1F MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-760s1c1
Sequence:CCGGCCATCAACAGACTTTGATAAACTCGAGTTTATCAAAGTCTGTTGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-531s1c1
Sequence:CCGGCCACATTGTTTCCACCATTTACTCGAGTAAATGGTGGAAACAATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-943s1c1
Sequence:CCGGGTTGTTAATGTCTGTGACAAACTCGAGTTTGTCACAGACATTAACAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-232s1c1
Sequence:CCGGCCCTTCAGCATTGTGTATATTCTCGAGAATATACACAATGCTGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-710s1c1
Sequence:CCGGGCACTAAATCAGTTTCCACATCTCGAGATGTGGAAACTGATTTAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000866.3-286s21c1
Sequence:CCGGTTGTGATCGCTGCAATTATTGCTCGAGCAATAATTGCAGCGATCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000866.3-1166s21c1
Sequence:CCGGGTATCTCAATTCCCTTATAAACTCGAGTTTATAAGGGAATTGAGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000866.3-1369s21c1
Sequence:CCGGGCTAAATTGATAAGGCTATAACTCGAGTTATAGCCTTATCAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000866
HTR1F MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-760s1c1
Sequence:CCGGCCATCAACAGACTTTGATAAACTCGAGTTTATCAAAGTCTGTTGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-531s1c1
Sequence:CCGGCCACATTGTTTCCACCATTTACTCGAGTAAATGGTGGAAACAATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-943s1c1
Sequence:CCGGGTTGTTAATGTCTGTGACAAACTCGAGTTTGTCACAGACATTAACAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-232s1c1
Sequence:CCGGCCCTTCAGCATTGTGTATATTCTCGAGAATATACACAATGCTGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-710s1c1
Sequence:CCGGGCACTAAATCAGTTTCCACATCTCGAGATGTGGAAACTGATTTAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000866.3-286s21c1
Sequence:CCGGTTGTGATCGCTGCAATTATTGCTCGAGCAATAATTGCAGCGATCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000866.3-1166s21c1
Sequence:CCGGGTATCTCAATTCCCTTATAAACTCGAGTTTATAAGGGAATTGAGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000866.3-1369s21c1
Sequence:CCGGGCTAAATTGATAAGGCTATAACTCGAGTTATAGCCTTATCAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000866
HTR1F MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-760s1c1
Sequence:CCGGCCATCAACAGACTTTGATAAACTCGAGTTTATCAAAGTCTGTTGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-531s1c1
Sequence:CCGGCCACATTGTTTCCACCATTTACTCGAGTAAATGGTGGAAACAATGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-943s1c1
Sequence:CCGGGTTGTTAATGTCTGTGACAAACTCGAGTTTGTCACAGACATTAACAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-232s1c1
Sequence:CCGGCCCTTCAGCATTGTGTATATTCTCGAGAATATACACAATGCTGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000866.1-710s1c1
Sequence:CCGGGCACTAAATCAGTTTCCACATCTCGAGATGTGGAAACTGATTTAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000866.3-286s21c1
Sequence:CCGGTTGTGATCGCTGCAATTATTGCTCGAGCAATAATTGCAGCGATCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000866.3-1166s21c1
Sequence:CCGGGTATCTCAATTCCCTTATAAACTCGAGTTTATAAGGGAATTGAGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357490    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000866.3-1369s21c1
Sequence:CCGGGCTAAATTGATAAGGCTATAACTCGAGTTATAGCCTTATCAATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008310
HTR1F MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000422208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008310.3-1390s21c1
Sequence:CCGGACTTGTACGATGCCGATATTACTCGAGTAATATCGGCATCGTACAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008310.3-1634s21c1
Sequence:CCGGATGCAGCTCAGCTCGTAATATCTCGAGATATTACGAGCTGAGCTGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008310.3-1585s21c1
Sequence:CCGGGTATTCATTTGGCCATAATTTCTCGAGAAATTATGGCCAAATGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008310
HTR1F MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000422208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008310.3-1390s21c1
Sequence:CCGGACTTGTACGATGCCGATATTACTCGAGTAATATCGGCATCGTACAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008310.3-1634s21c1
Sequence:CCGGATGCAGCTCAGCTCGTAATATCTCGAGATATTACGAGCTGAGCTGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008310.3-1585s21c1
Sequence:CCGGGTATTCATTTGGCCATAATTTCTCGAGAAATTATGGCCAAATGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008310
HTR1F MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 1F, G protein-coupled
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000422208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008310.3-1390s21c1
Sequence:CCGGACTTGTACGATGCCGATATTACTCGAGTAATATCGGCATCGTACAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416617    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008310.3-1634s21c1
Sequence:CCGGATGCAGCTCAGCTCGTAATATCTCGAGATATTACGAGCTGAGCTGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008310.3-1585s21c1
Sequence:CCGGGTATTCATTTGGCCATAATTTCTCGAGAAATTATGGCCAAATGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)